ID: 975106628

View in Genome Browser
Species Human (GRCh38)
Location 4:70574579-70574601
Sequence ACATATGTCCCTGTATGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975106626_975106628 -9 Left 975106626 4:70574565-70574587 CCCTATCATGAGCTACATATGTC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106622_975106628 22 Left 975106622 4:70574534-70574556 CCACATATTCCAGGGCCAGTGGC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106625_975106628 -5 Left 975106625 4:70574561-70574583 CCAGCCCTATCATGAGCTACATA No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106623_975106628 13 Left 975106623 4:70574543-70574565 CCAGGGCCAGTGGCACGTCCAGC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106627_975106628 -10 Left 975106627 4:70574566-70574588 CCTATCATGAGCTACATATGTCC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data
975106624_975106628 7 Left 975106624 4:70574549-70574571 CCAGTGGCACGTCCAGCCCTATC No data
Right 975106628 4:70574579-70574601 ACATATGTCCCTGTATGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975106628 Original CRISPR ACATATGTCCCTGTATGTCC CGG Intergenic
No off target data available for this crispr