ID: 975110930

View in Genome Browser
Species Human (GRCh38)
Location 4:70625706-70625728
Sequence TCTGAGCTAGAACTCAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975110930_975110933 10 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110933 4:70625739-70625761 TCGTAATATTCTGTGCAGGATGG No data
975110930_975110936 15 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110936 4:70625744-70625766 ATATTCTGTGCAGGATGGGTGGG No data
975110930_975110934 11 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110934 4:70625740-70625762 CGTAATATTCTGTGCAGGATGGG No data
975110930_975110938 29 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110938 4:70625758-70625780 ATGGGTGGGCACCCAAGTCAGGG No data
975110930_975110937 28 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110937 4:70625757-70625779 GATGGGTGGGCACCCAAGTCAGG No data
975110930_975110932 6 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110932 4:70625735-70625757 GCTATCGTAATATTCTGTGCAGG No data
975110930_975110935 14 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110935 4:70625743-70625765 AATATTCTGTGCAGGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975110930 Original CRISPR TCTGAGCTAGAACTCAGTGG TGG (reversed) Intergenic
No off target data available for this crispr