ID: 975110937

View in Genome Browser
Species Human (GRCh38)
Location 4:70625757-70625779
Sequence GATGGGTGGGCACCCAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975110929_975110937 29 Left 975110929 4:70625705-70625727 CCCACCACTGAGTTCTAGCTCAG No data
Right 975110937 4:70625757-70625779 GATGGGTGGGCACCCAAGTCAGG No data
975110930_975110937 28 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110937 4:70625757-70625779 GATGGGTGGGCACCCAAGTCAGG No data
975110931_975110937 25 Left 975110931 4:70625709-70625731 CCACTGAGTTCTAGCTCAGAAAA No data
Right 975110937 4:70625757-70625779 GATGGGTGGGCACCCAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975110937 Original CRISPR GATGGGTGGGCACCCAAGTC AGG Intergenic
No off target data available for this crispr