ID: 975110938

View in Genome Browser
Species Human (GRCh38)
Location 4:70625758-70625780
Sequence ATGGGTGGGCACCCAAGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975110931_975110938 26 Left 975110931 4:70625709-70625731 CCACTGAGTTCTAGCTCAGAAAA No data
Right 975110938 4:70625758-70625780 ATGGGTGGGCACCCAAGTCAGGG No data
975110929_975110938 30 Left 975110929 4:70625705-70625727 CCCACCACTGAGTTCTAGCTCAG No data
Right 975110938 4:70625758-70625780 ATGGGTGGGCACCCAAGTCAGGG No data
975110930_975110938 29 Left 975110930 4:70625706-70625728 CCACCACTGAGTTCTAGCTCAGA No data
Right 975110938 4:70625758-70625780 ATGGGTGGGCACCCAAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975110938 Original CRISPR ATGGGTGGGCACCCAAGTCA GGG Intergenic
No off target data available for this crispr