ID: 975112178

View in Genome Browser
Species Human (GRCh38)
Location 4:70640494-70640516
Sequence TTGCAACTGCATAAAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975112177_975112178 2 Left 975112177 4:70640469-70640491 CCAGAGAATTCAACGTAGTTGTG 0: 1
1: 0
2: 0
3: 6
4: 62
Right 975112178 4:70640494-70640516 TTGCAACTGCATAAAGTGCAAGG 0: 1
1: 0
2: 2
3: 12
4: 131
975112176_975112178 3 Left 975112176 4:70640468-70640490 CCCAGAGAATTCAACGTAGTTGT 0: 1
1: 0
2: 1
3: 9
4: 103
Right 975112178 4:70640494-70640516 TTGCAACTGCATAAAGTGCAAGG 0: 1
1: 0
2: 2
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975112178 Original CRISPR TTGCAACTGCATAAAGTGCA AGG Intronic
902305405 1:15534400-15534422 TAGAAACTGCATCAAGGGCATGG - Intronic
907695461 1:56722689-56722711 TTGCCAAAGCAGAAAGTGCAAGG + Intronic
913524224 1:119675846-119675868 TGTCAACTGCACAAAGTGCTGGG - Intronic
916217878 1:162413289-162413311 TTGAAACAGCAAAAAGGGCAAGG - Intergenic
919593297 1:199531055-199531077 TTGCTAAAGCATAAAGTGTAAGG - Intergenic
921289284 1:213640918-213640940 TTGCAACTTCAAAAACAGCAAGG - Intergenic
923290352 1:232539314-232539336 TTACAACTGCAAAAAGTCTAAGG + Intronic
923582067 1:235227191-235227213 TTGCTATAGCATAAAGTTCAAGG + Intronic
1062936042 10:1390776-1390798 CTGCATCTACATAAAGTGAAGGG + Intronic
1064100329 10:12458168-12458190 GTGCAACAGCAGACAGTGCATGG - Intronic
1064435912 10:15311074-15311096 CTGTAACTGCATGAAGAGCAGGG - Intronic
1065297258 10:24288969-24288991 TGGCAGCTGTATAAATTGCAGGG - Intronic
1068709030 10:60111928-60111950 ATGTAGCTGCATAAACTGCAAGG + Intronic
1070169973 10:73925586-73925608 TTGCAAATGAATAGAGTACAGGG + Intergenic
1073720511 10:106164817-106164839 ATGCAAATGCATTAAGGGCAGGG + Intergenic
1077521828 11:3040853-3040875 GTGCAACTGCAGAAGCTGCAGGG + Intronic
1078220094 11:9344562-9344584 TTGCAACTGCAGCAACTACAAGG + Intergenic
1080334122 11:31175805-31175827 TTGCAACTGAAGAAACTGCATGG + Intronic
1084576840 11:69994023-69994045 TTGGAACTTGATCAAGTGCAGGG - Intergenic
1085728450 11:78975646-78975668 TTGCCACTGTATAAATTGAATGG - Intronic
1086283987 11:85223903-85223925 TTCCAACTGGATATTGTGCAGGG + Intronic
1090566847 11:128003623-128003645 TTGAAACTGCAGAAAGTCAAAGG - Intergenic
1090643630 11:128749806-128749828 TTTCCACTGCGTAAAGGGCAGGG - Intronic
1092756063 12:11764609-11764631 TTGCAGATGTATAAAGGGCATGG + Intronic
1093805265 12:23424693-23424715 TTGTAACTGCATTAAATGAACGG + Intergenic
1093938877 12:25031136-25031158 TTGAAACTTCAAAATGTGCATGG - Intronic
1094677086 12:32631069-32631091 TTGAAACTGCATAAACAACAGGG - Intronic
1095657571 12:44687764-44687786 TTGCAACTTCATTAAGTTTAAGG - Intronic
1096422829 12:51474898-51474920 CCGCAACTGCATAAAGGTCAAGG + Intronic
1099546888 12:83994113-83994135 TTGCAACTGAAAAAGCTGCAAGG + Intergenic
1102732221 12:115121621-115121643 TTGCAACTGCTAAAAGTACAGGG - Intergenic
1106854590 13:33835855-33835877 ATTTAACTGCACAAAGTGCAAGG - Intronic
1106915855 13:34513749-34513771 TTTCAGCTGAATAAAATGCATGG - Intergenic
1107227041 13:38063797-38063819 TTGTAAGTGCATTAAATGCATGG + Intergenic
1108766380 13:53635330-53635352 TTGCTAGTACATAAAGTGCCAGG - Intergenic
1108951432 13:56099311-56099333 TTGCAACTGCACAGAGTGCAAGG - Intergenic
1111259753 13:85721618-85721640 TTGCACCTGCACAAAGTTCATGG + Intergenic
1114712155 14:24789500-24789522 TTGAAACTGAATAAAGGGGATGG - Intergenic
1117898875 14:60513408-60513430 ATGCAAGTGCAGCAAGTGCAAGG + Intronic
1120524062 14:85557301-85557323 TTGCAAATGCCTTAAGAGCAAGG + Intronic
1121751084 14:96357340-96357362 ATGGAACTGCACAAAGTGCGTGG - Intronic
1123714427 15:23015759-23015781 TTACAACTGAAGAAAGTACATGG + Intronic
1123927376 15:25129865-25129887 TTGCATCTGCTTAAAGTGCCAGG - Intergenic
1125807795 15:42509150-42509172 TTGCAACTACAAAAAGTAAATGG - Intronic
1127853183 15:62933376-62933398 TTGAAACTGCAAAAAATCCAGGG + Intergenic
1134767708 16:16775213-16775235 TTGGAACTGCATTAAATCCATGG + Intergenic
1135325732 16:21524344-21524366 TGGCAGCTGCAAAGAGTGCAGGG - Intergenic
1138155825 16:54702129-54702151 TTGGAAGTTCATTAAGTGCAGGG - Intergenic
1139145883 16:64325112-64325134 CTGCATCTGTATACAGTGCAGGG - Intergenic
1142038746 16:87878989-87879011 TGGCAGCTGCAAAGAGTGCAGGG - Intergenic
1146636933 17:34513461-34513483 TGGCTGCTGCAAAAAGTGCATGG + Intergenic
1153582887 18:6593150-6593172 TTGCAAATGCATAGAGTGGAAGG + Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1158161537 18:54490218-54490240 ATGCAAATGCATATAGTCCAGGG + Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1159522358 18:69542644-69542666 CTGAAACTGCAAAAAGTACATGG - Intronic
1163342900 19:16721235-16721257 TTGCAACATCCTAAAATGCATGG + Intronic
1167823173 19:51948597-51948619 GTGCAACTGCATACAGTGTGTGG - Intronic
1168517646 19:57021794-57021816 TTGCAGATTCATAAAGTGCAAGG + Intergenic
925764529 2:7218333-7218355 TGGCCACTGCATCAAGAGCAAGG - Intergenic
927639768 2:24839250-24839272 TTGCAACTGAGAAACGTGCAAGG - Intronic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
932753520 2:74388475-74388497 TTGCAGATGCATAAAGGGAAAGG - Intronic
935263889 2:101378451-101378473 TTCCAACTGCCTGAAGGGCAAGG - Intronic
935659847 2:105456983-105457005 TTGCAACTTCATTAAGAGCTTGG + Intergenic
936438542 2:112529751-112529773 TAGCTACTGCAGAAAGTGCTTGG - Exonic
936968764 2:118153679-118153701 TTACAAGTGCATAATTTGCAAGG - Intergenic
937315667 2:120930720-120930742 CTGCAACTGCATTACCTGCAAGG - Intronic
938366829 2:130741162-130741184 TAGCAAATGCAGAAAGGGCACGG + Intergenic
938707041 2:133940815-133940837 TTTCTACTGCATAAGTTGCATGG + Intergenic
938986631 2:136582902-136582924 ATGCAACTCAAGAAAGTGCAGGG + Intergenic
944506523 2:200418113-200418135 TTTCAATTGTATAAAATGCAGGG + Intronic
947392946 2:229657865-229657887 TTGCAACTTCCTAAATTTCAGGG + Intronic
947683522 2:232059180-232059202 TTGCAACAGCATAAACTGTAAGG + Intronic
948573497 2:238934114-238934136 TTGCAAAAGAATAAAGTGGAAGG + Intergenic
1169369898 20:5020657-5020679 TTGCAACCTCCTAAAGAGCAAGG - Intergenic
1171747930 20:29017777-29017799 CTGCAAATCCATAAAGTCCAGGG - Intergenic
1175600034 20:60265800-60265822 TTGCTACTGCATACAGTGGGTGG + Intergenic
1181308780 22:21932390-21932412 TTGCAGCTGCAGAGATTGCATGG + Intronic
1181976551 22:26734918-26734940 TTACAACTGCATAAAGTTCAGGG - Intergenic
1184318956 22:43724252-43724274 TTGCAACTGTATAAAAAGGATGG + Intronic
1184645549 22:45892837-45892859 GTGCAACTGCTTTTAGTGCACGG + Intergenic
1185033784 22:48460283-48460305 TTGCAGCAGCATTGAGTGCAGGG - Intergenic
949808828 3:7984115-7984137 TTTCAAGTGAATAAAGAGCAAGG + Intergenic
953395865 3:42569261-42569283 TTACAACTGCAGAAAAGGCAGGG - Intronic
956854058 3:73258508-73258530 TTGCACCTGCAAAAAGTGTAGGG - Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
960079487 3:113526046-113526068 TTGCAACTGGATTGAGGGCAAGG + Intergenic
961917002 3:130386740-130386762 CTGCAACTACCTGAAGTGCAAGG - Intronic
962395766 3:135014231-135014253 CTGCAACTGCATCAAGTGTTTGG + Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962534175 3:136312328-136312350 TTACAACTGCATACAGTGTTTGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965381118 3:167989897-167989919 TTTCACCTGCTTTAAGTGCATGG + Intergenic
972986399 4:44771248-44771270 TTGCAAATGCCTAAGGTACAAGG + Intergenic
975112178 4:70640494-70640516 TTGCAACTGCATAAAGTGCAAGG + Intronic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
977286852 4:95118458-95118480 TTGTAACTGCTTAAAATGCCAGG - Intronic
978274331 4:106931042-106931064 ATGCAACTGCAGGAGGTGCAGGG + Intronic
979005595 4:115291702-115291724 TTTCAACTGTATTAAGTGTAAGG + Intergenic
979149373 4:117290066-117290088 TTGAAGCTGCAGAAAGTGAAAGG - Intergenic
979809094 4:125013137-125013159 TTGGATCTGCTTAAAGGGCAAGG + Intergenic
980417162 4:132505601-132505623 TTGCAAATGGACAAAGTGTATGG - Intergenic
982128709 4:152207281-152207303 TTGGAACTGCATAACATGAAAGG + Intergenic
982424777 4:155245845-155245867 TTACAACTGCAAAAAGTACATGG - Intergenic
988121591 5:26970659-26970681 TTACAATTGCATAAATTCCAAGG - Intronic
989665827 5:43852930-43852952 TTGCAATTGCATAAAATTGAGGG - Intergenic
990547949 5:56842569-56842591 TTGCAATGGCACCAAGTGCATGG - Intronic
994160011 5:96547091-96547113 TTTTTACTGCATAAAGTGAATGG - Intronic
996456136 5:123684596-123684618 TTGCAACTTCAAAATCTGCAGGG + Intergenic
998510347 5:142708229-142708251 TTTCCACAACATAAAGTGCAAGG + Intergenic
1000408077 5:160909803-160909825 TCACAACTGCAGAGAGTGCAGGG + Intergenic
1000673475 5:164091388-164091410 TCACAACTGGATAAAGTTCATGG - Intergenic
1000936718 5:167310552-167310574 CTGCAACTGCATCAAATGAAAGG - Intronic
1007790297 6:44304769-44304791 TTGCAACTGTATACAGAGGACGG - Exonic
1008297777 6:49799040-49799062 TTTCAAGTGCATACAGTGGAGGG - Intergenic
1013491765 6:110654443-110654465 TTGCAACTTCCTAGAGGGCAGGG + Intronic
1013730052 6:113154702-113154724 TTGCAACTGTATAAAAAGGACGG - Intergenic
1016276731 6:142361764-142361786 TTGAAACAACATAAACTGCATGG - Intronic
1020176223 7:5884310-5884332 ATGCACCTGCATAAAGCGCGAGG + Intronic
1020885874 7:13818804-13818826 TTGCTGAGGCATAAAGTGCAAGG + Intergenic
1020961997 7:14816529-14816551 TAGCAAGTGAATAAAGAGCATGG + Intronic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1023199770 7:37683782-37683804 TTGCAAATGCATGCAGAGCATGG + Intronic
1024227498 7:47337233-47337255 TTGCAACAGGAGAAAGTGCTGGG - Intronic
1024537070 7:50445820-50445842 TTGCAACAGCAAACAATGCACGG + Exonic
1028431333 7:90750095-90750117 TTGCAACTGCAGAGAATGCTGGG - Intronic
1031844834 7:126792608-126792630 TTGAAACTGCTTGAATTGCAGGG - Intronic
1037634391 8:20688235-20688257 TTGCAACTGTATTAGGTGCGGGG + Intergenic
1039340902 8:36648803-36648825 TTGAAACAGCATAAATTGGAGGG + Intergenic
1042807604 8:72788733-72788755 TTGCAATTTCATATAGTGAATGG - Intronic
1045037292 8:98185510-98185532 TTGCAGGTGTATAAAGTTCATGG - Intergenic
1045772130 8:105755025-105755047 TTGTAGCAGCATGAAGTGCAGGG + Intronic
1048063190 8:130941765-130941787 TTGCTAGAGGATAAAGTGCAGGG - Intronic
1051088350 9:13378390-13378412 TTGGAACAGACTAAAGTGCATGG - Intergenic
1051669820 9:19498132-19498154 TTATAACTCCATAAAGTGCCTGG - Intergenic
1052741130 9:32394088-32394110 TTGCACGTGGATAAAGTACAGGG - Intronic
1053068584 9:35086917-35086939 AGGCTACTGCAAAAAGTGCAGGG + Intergenic
1055758562 9:79581848-79581870 CTGCAACTGCCTAGAGTCCATGG + Intronic
1185455622 X:309224-309246 TTCCAAGTGCATGAAGAGCACGG - Intronic
1189821844 X:44876225-44876247 TTGCAACCGCATATAGTTCTTGG + Intronic
1197318535 X:124998845-124998867 TTGCAAGTGTAATAAGTGCATGG - Intergenic
1197809841 X:130431402-130431424 TTGTAAATGTATAAAGGGCAAGG + Intergenic
1198275532 X:135095176-135095198 CTGCAAATAAATAAAGTGCATGG + Intergenic
1198879917 X:141269109-141269131 TTGTTACTGCATACACTGCATGG + Intergenic
1200301678 X:154982662-154982684 TCGCAACTGCATAAAATTAACGG + Intronic