ID: 975114149

View in Genome Browser
Species Human (GRCh38)
Location 4:70660329-70660351
Sequence GTAAAAGCACTGTGAATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975114149 Original CRISPR GTAAAAGCACTGTGAATGTG GGG Intronic
900261333 1:1731410-1731432 ACAAAGGCACTGTGAGTGTGTGG - Intronic
905750917 1:40463061-40463083 GGAAAAGCCCTATGAATGTAGGG + Exonic
907018830 1:51045169-51045191 GTTGAAGCACTTTGAAAGTGAGG - Intergenic
908578639 1:65489712-65489734 CTAAAAGCCCAATGAATGTGGGG - Intronic
909398614 1:75198943-75198965 GTAAAAGCACTGTGAAAAAGAGG + Intergenic
910324855 1:85995381-85995403 TTAAAAACACTGTGAATATCTGG - Intronic
912436415 1:109665084-109665106 GTAAAATCATTGTGCTTGTGAGG + Intronic
912441025 1:109698259-109698281 GTAAAATCATTGTGTTTGTGAGG + Intronic
913008366 1:114657485-114657507 GTAGAAGTACTATCAATGTGTGG + Intronic
915725854 1:158017040-158017062 GTAAATGCTCCGTGAATGTGGGG - Intronic
915973503 1:160370442-160370464 GGTAAGGAACTGTGAATGTGAGG - Intronic
917268933 1:173251982-173252004 GTAAATGCCCTGTTATTGTGTGG + Intergenic
918444398 1:184602393-184602415 GTAAAAACACTGTGAACCAGTGG + Intronic
920199026 1:204248047-204248069 GAAAAAGCCCCGTGAAAGTGTGG - Intronic
921126959 1:212186540-212186562 GAAAATGTACAGTGAATGTGAGG + Intergenic
921446483 1:215253168-215253190 TTAAAAGCACAGTGAAAGTCAGG + Intergenic
923515848 1:234697460-234697482 GCAAAGGCAATGGGAATGTGGGG + Intergenic
1063381371 10:5588314-5588336 GGAAAAGCACTTGGAATGAGCGG - Intergenic
1064639384 10:17400075-17400097 GTAAAAGAACTGGCAAAGTGAGG + Intronic
1064859273 10:19809228-19809250 ATAAATGCATTGGGAATGTGGGG + Intergenic
1065820369 10:29519620-29519642 ATAAAAGTACTGTGAAGGTAAGG + Intronic
1066335725 10:34476294-34476316 TTAAAAACACTGCGAGTGTGTGG + Intronic
1066469150 10:35681251-35681273 GTAAAAGTCCCGTGCATGTGGGG + Intergenic
1070105993 10:73431947-73431969 GAAAATGCAATGAGAATGTGAGG - Intronic
1070458673 10:76643313-76643335 GTATAGGCACTGTGAAAGGGAGG + Intergenic
1073469850 10:103715806-103715828 GGAATAGCACTGAGAATGTGGGG - Intronic
1073842043 10:107508948-107508970 TTCAAAGCAATGTGAAGGTGAGG - Intergenic
1075288200 10:121205165-121205187 GTAAGAGCAATGGAAATGTGAGG - Intergenic
1077078748 11:713237-713259 GTAAAAGCCATGTGTACGTGGGG + Intronic
1077652493 11:3985862-3985884 GTACAAGTACACTGAATGTGAGG - Intronic
1078962920 11:16300517-16300539 GTAAAAGCACTATTAGAGTGGGG - Intronic
1080173526 11:29334961-29334983 GGAAAAGCACTGTGGATTTTAGG + Intergenic
1080703642 11:34667687-34667709 GGAAGAGCCCTGTGAATATGGGG - Intergenic
1081412527 11:42776571-42776593 GGAATGGCACTGTGACTGTGGGG + Intergenic
1087409693 11:97776013-97776035 CTAAAAGGACTGTGGATATGTGG - Intergenic
1087949389 11:104201918-104201940 GTAAAGGCACTGTGCCCGTGAGG - Intergenic
1088446157 11:109930857-109930879 GCAGAAACACTGTGAATTTGTGG + Intergenic
1088803793 11:113332459-113332481 GTGAATGCACTGTGAATATTTGG + Intronic
1092251760 12:6902828-6902850 GTAAAAGCTCTATAAATGTTGGG + Intronic
1094365689 12:29677775-29677797 GTACAAGCACTGTGATGCTGCGG - Intronic
1095729001 12:45484892-45484914 ATACAAGTACTGTGCATGTGTGG - Intergenic
1096265643 12:50120398-50120420 GTAATAGCAATGTGAGGGTGAGG + Exonic
1096652380 12:53068260-53068282 GCAAAAGCATCGTGGATGTGGGG - Exonic
1098573536 12:72015250-72015272 GTAAAAACACTGTGAAAGGAAGG + Intronic
1098626004 12:72669512-72669534 GTAAATGCACTGTACATTTGAGG - Exonic
1099144917 12:79030375-79030397 AGAAAAGCACTGGGAATGTTTGG - Intronic
1101288852 12:103345456-103345478 GTAAAAGTGCTGTGAATGGATGG - Intronic
1104101979 12:125621349-125621371 ATAAAAGCAAGGTGAATGTAAGG + Intronic
1104436646 12:128762160-128762182 CTAAAATCACTGTGGCTGTGTGG - Intergenic
1105376651 13:19851581-19851603 GTATAAGCTCTGTGAATGCTGGG - Intronic
1105725067 13:23155209-23155231 GTAAAAACAGTGTGAGTTTGTGG - Intergenic
1109467578 13:62757063-62757085 TTAAAAGCACTGTCTATTTGAGG + Intergenic
1112270081 13:97960404-97960426 GTAAAAATACTGTGAATGATAGG + Intronic
1115259829 14:31440692-31440714 GTAAAAGCCCTGTGGCTGGGTGG + Intronic
1116035224 14:39619310-39619332 TGAAAAGCACTGTGGATGAGAGG - Intergenic
1117322004 14:54633463-54633485 GTAAGATCACTCTGGATGTGGGG + Intronic
1118247998 14:64130456-64130478 GTGAAAGCTCTGTGAATGTAAGG - Intronic
1125156380 15:36591390-36591412 GTAAATGGACTGGGAATATGAGG + Intronic
1126232755 15:46345916-46345938 GTGGTTGCACTGTGAATGTGAGG - Intergenic
1126331001 15:47531526-47531548 GTAAAGGCACTGTATATATGTGG + Intronic
1129264064 15:74384616-74384638 GTAAACGTGCTGTGAATGAGTGG + Intergenic
1131623108 15:94088404-94088426 AAAACAGCACTGTGAATATGTGG + Intergenic
1132135174 15:99329592-99329614 GTATAAGCATTGGGCATGTGTGG + Intronic
1134362375 16:13543591-13543613 GAAACAGCACTGGGAGTGTGGGG - Intergenic
1134411028 16:14003414-14003436 GGAAGAGCACTGTGAGCGTGCGG - Intergenic
1138697900 16:58832899-58832921 ATCAAAGCAATGTGAATCTGGGG - Intergenic
1140878255 16:79173319-79173341 GTAAAAACACTTTGTATGTTTGG + Intronic
1141414065 16:83856464-83856486 GTCACAGCTCTGTGAGTGTGGGG - Intergenic
1148957668 17:51366901-51366923 CTCATAGCACTGTGAGTGTGTGG + Intergenic
1150854493 17:68738099-68738121 GAAATAGCACTTAGAATGTGAGG - Intergenic
1150879795 17:69011314-69011336 GGAAAAAGACAGTGAATGTGTGG + Intronic
1154171921 18:12058685-12058707 GTACTAGGTCTGTGAATGTGTGG - Intergenic
1154175382 18:12084437-12084459 GTACTAGGTCTGTGAATGTGTGG + Intergenic
1158406920 18:57168019-57168041 GGCACAGCACTGAGAATGTGTGG + Intergenic
1158449166 18:57547934-57547956 TTAAAAGCCCTTTAAATGTGAGG - Intergenic
1165007706 19:32820021-32820043 GTCAAAGCTCAGTGAGTGTGAGG + Intronic
924989150 2:296457-296479 GTAAAAGCACTGGGCATCTCGGG + Intergenic
927829604 2:26338160-26338182 TTAAATCCACTGTGAAGGTGTGG - Intronic
931016119 2:57982565-57982587 GAAAAAGCACTCTGAAGGTTAGG + Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934960162 2:98666076-98666098 GTAAAAGCACTTTGGAAGAGTGG + Intronic
935299113 2:101677975-101677997 TCAAAAGCACTGTGAATTAGGGG - Intergenic
936051472 2:109227277-109227299 GAAGAAGCTCTGTGAATGTCAGG + Intronic
936454675 2:112663433-112663455 GTTAAATCCCTGTGCATGTGAGG - Exonic
936866471 2:117080435-117080457 GGAAAATTACTGTGAATTTGTGG - Intergenic
937874074 2:126807541-126807563 GTAAGAGCACCGTGAAACTGGGG - Intergenic
940617537 2:156068605-156068627 GTTAAAGGACTGTGGGTGTGTGG - Intergenic
942161499 2:173193313-173193335 GTAAAAGCACTGTATGTGTGTGG - Intronic
943550290 2:189330424-189330446 GTAAAAGCCCTGTGAACCTCCGG - Intergenic
943562411 2:189479537-189479559 GAAAAATCACTGTGTAAGTGTGG + Intergenic
944426707 2:199591042-199591064 GCAAAAGGACTGTGACTGTCAGG + Intergenic
946607001 2:221416296-221416318 GTGAAACCACTGAGAATGTGGGG + Intergenic
946803611 2:223448009-223448031 GTAAAAGAATTATGAATGTATGG + Intergenic
1169111614 20:3037633-3037655 GGAAAACCTCTGTGGATGTGCGG - Intronic
1169701513 20:8452385-8452407 GGAAAAGCACTGAGATTTTGAGG + Intronic
1170428201 20:16256245-16256267 GGTAAAGCACTGTGTCTGTGAGG - Intergenic
1172807616 20:37623709-37623731 GTAAGAGCTCAGTGAATGTTAGG - Intergenic
1173038124 20:39432354-39432376 GCAGAAGCATTGTAAATGTGTGG - Intergenic
1175122705 20:56728646-56728668 TTCAAAGCACTTTGAATTTGTGG + Intergenic
1178675423 21:34627434-34627456 GAAAAATCAATGTGAATTTGAGG - Intergenic
1179096801 21:38323385-38323407 GTAAAACCACTGTGATTTGGCGG + Intergenic
1181172455 22:21017327-21017349 GTGAGAGCACTGTGAATTTGGGG - Intronic
1183366031 22:37407423-37407445 GTGAAAGCACTGTGAGGCTGGGG - Intronic
1184318230 22:43715930-43715952 GTAAAAGTTCTATGAATGTTGGG + Intronic
953510309 3:43530617-43530639 ATAAAAGTTATGTGAATGTGGGG - Intronic
953660876 3:44890727-44890749 GTAAAGGTACTGTGAATCTCAGG + Exonic
954002202 3:47566576-47566598 CTGAAAGCACTGTGGATGTGAGG - Intronic
956369635 3:68544622-68544644 GTAAACGCACTGTGATTATCTGG - Exonic
957593460 3:82229496-82229518 GTGAAACCACTATGAATATGAGG - Intergenic
957894733 3:86407317-86407339 GTGATAGAACAGTGAATGTGTGG - Intergenic
959343585 3:105163066-105163088 GGAAAAGCAATGGGAATGTGGGG - Intergenic
960306882 3:116072474-116072496 GTCCAATCACTGTGAAAGTGTGG - Intronic
962620631 3:137174551-137174573 GTAAGAGCTGTGTGGATGTGGGG + Intergenic
963108274 3:141664754-141664776 GCAAAGGCACTGTGAAAGTAAGG - Intergenic
963356221 3:144211793-144211815 GTAAAAGCAGGATGAAAGTGGGG + Intergenic
963497742 3:146088888-146088910 GTAAAATCACTTTGATTGGGGGG - Intronic
964065630 3:152575256-152575278 GTCAAAGCTCTGTAAATCTGTGG - Intergenic
964224980 3:154388195-154388217 GTAAAAGCACTATAAATGTAAGG - Intronic
965300633 3:167001442-167001464 GTAAAAGCTCTGTGAGCATGTGG + Intergenic
969223248 4:5775222-5775244 GTAAAAACACTTTCAATGAGTGG - Intronic
970469012 4:16357327-16357349 CCAAAAGGACTGTGAATGTCTGG - Intergenic
970645773 4:18118631-18118653 GTAAATGCAGTGGGAGTGTGTGG + Intergenic
972228557 4:37043428-37043450 GTAGAAGCACTGAGAAAGTGGGG + Intergenic
973253008 4:48080287-48080309 CTTAATGCACTGAGAATGTGGGG + Intronic
973349093 4:49089564-49089586 GTAAAAACACTCAGGATGTGTGG + Intergenic
975114149 4:70660329-70660351 GTAAAAGCACTGTGAATGTGGGG + Intronic
975318116 4:72978613-72978635 GTAAAGGCAGTGGTAATGTGTGG - Intergenic
976878441 4:89887492-89887514 CCAAAATCACTGTAAATGTGTGG - Intronic
978135407 4:105251901-105251923 GTAAAAGCACATTGAATGAAAGG + Intronic
979683782 4:123488969-123488991 GTAAAGGGACTGGAAATGTGGGG - Intergenic
980490152 4:133514327-133514349 TTAAGAGCATTATGAATGTGGGG - Intergenic
981930833 4:150187701-150187723 GTAAAAACACTTTAAATGGGTGG + Intronic
982170778 4:152659794-152659816 GAAAAAACACAGTGTATGTGGGG - Intronic
983124780 4:163937458-163937480 GTAAAACCACTGAGGATTTGAGG - Intronic
983534426 4:168842152-168842174 CTAAAAGCACGGTGAATGAAAGG - Intronic
984597790 4:181690352-181690374 AAAAAAGCTCTGTGATTGTGTGG + Intergenic
985011427 4:185586740-185586762 GTAAAAGCAGTGTTAGTGAGAGG - Intronic
985429122 4:189860990-189861012 ATAAAAACACTGTAAATATGTGG + Intergenic
985689868 5:1301341-1301363 AAAAAAGCACCGTGAATGAGAGG + Intergenic
986516587 5:8571105-8571127 ATAAAGGCTCTGAGAATGTGGGG - Intergenic
986958520 5:13186242-13186264 GTAAAACCACAGTGAAAGTCTGG - Intergenic
987631357 5:20477476-20477498 GAAAGAGCACAGTGATTGTGAGG + Intronic
988441541 5:31239601-31239623 GTAAAAGCAAGGTGAATTTAGGG + Intronic
991269575 5:64763822-64763844 GTAAAAGTACAGTGCAAGTGTGG - Intronic
994184644 5:96804645-96804667 ATAAAAGCAATGTGAATTTCAGG + Intronic
996525743 5:124477457-124477479 GTATAAACATTGTGAATGTCAGG - Intergenic
996650185 5:125866426-125866448 GGACAAGCACTGAGAACGTGGGG - Intergenic
997443990 5:133928025-133928047 GCACAGGCACTGTGAATATGTGG + Intergenic
1000647284 5:163773988-163774010 GCAAAAGCTCTTTGAAGGTGAGG + Intergenic
1002047952 5:176552614-176552636 GAAAAAGCACAGTGTCTGTGTGG - Intronic
1004571283 6:16848054-16848076 GTACAAGCACTGTGCAACTGTGG + Intergenic
1005677481 6:28169951-28169973 GAAAAAGCACAGTGCATCTGGGG + Intergenic
1005891633 6:30145079-30145101 GTCAAAGGACTGTGTGTGTGAGG - Intronic
1008014296 6:46501167-46501189 ATAAAAGCAATGTGCATTTGGGG + Intergenic
1010098096 6:72070814-72070836 CTAAAAGTGATGTGAATGTGAGG - Intronic
1010155482 6:72787153-72787175 CAAAAACCACTGTGAATTTGTGG - Intronic
1010289047 6:74114631-74114653 GGAAGAGAACTGAGAATGTGTGG + Intergenic
1012651821 6:101763318-101763340 TGAAAACCACTCTGAATGTGAGG + Intronic
1013297008 6:108766672-108766694 GGAAACGCTCTGTAAATGTGAGG + Intergenic
1013562488 6:111319507-111319529 GGAAAGGTACTGTGTATGTGTGG + Intronic
1014375858 6:120671965-120671987 TTTAAAGCACTGTAAATATGAGG + Intergenic
1014545626 6:122732215-122732237 GTAAATGCTATGTGAATATGTGG + Intergenic
1015923455 6:138288017-138288039 TTTAAAGAACTGTGAATGTAAGG - Intronic
1016193315 6:141298117-141298139 GTAATAGCACTGGGGATTTGAGG - Intergenic
1018529194 6:164744865-164744887 TTAACAGCACTGAGAATGTGAGG + Intergenic
1018607810 6:165617071-165617093 GAGAAAGCACTGTGCATTTGAGG - Intronic
1019082272 6:169442877-169442899 TTAATAGCATTGGGAATGTGTGG - Intergenic
1021212046 7:17865832-17865854 GTGAATTTACTGTGAATGTGTGG - Intronic
1021299385 7:18953721-18953743 GTAAAAACACTGTGAAAGTATGG + Intronic
1021404478 7:20248826-20248848 GTAACAGGACTGTGGATTTGGGG - Intergenic
1021417728 7:20407589-20407611 GTAAGATCAGTGTGGATGTGAGG - Intronic
1023154794 7:37238020-37238042 CTAAAACCACTGGTAATGTGTGG - Intronic
1024379572 7:48680689-48680711 TTAAAAGCAGTGTAAATATGAGG - Intergenic
1024811004 7:53212289-53212311 GTAAACGCATTTTGCATGTGAGG + Intergenic
1027832034 7:83189731-83189753 GTAAAAGAGTTTTGAATGTGTGG - Intergenic
1030638186 7:111973951-111973973 AAAAAAGTACTGTGAATGTGAGG - Intronic
1031101985 7:117492305-117492327 GTAAATGCAATGCAAATGTGAGG - Intronic
1031262325 7:119536597-119536619 GTAAAAGCAAGGTTAATGTGAGG - Intergenic
1036428843 8:8670894-8670916 ATAAAAGGACTGCTAATGTGGGG - Intergenic
1040546254 8:48400297-48400319 GTAAATAAACTGTGAATGCGAGG + Intergenic
1041211396 8:55554800-55554822 ATAAAAGCATTATGATTGTGTGG - Intergenic
1042050285 8:64696969-64696991 GTAAAAGTGCTGTGAAATTGTGG + Intronic
1042107848 8:65348093-65348115 GTAAAAGCCTGGTGCATGTGAGG + Intergenic
1044629817 8:94267343-94267365 GTAGAAGTTCTGTGAATGTAAGG - Intergenic
1048621789 8:136141608-136141630 GTAAGAGCACTGGGGATATGGGG + Intergenic
1051155795 9:14144319-14144341 GTAATAACCTTGTGAATGTGTGG - Intronic
1051895761 9:21987167-21987189 GTAAAAGCACAGTGATGGGGGGG - Intronic
1052075877 9:24139599-24139621 ATAAAAGCACTGAGTAAGTGTGG + Intergenic
1055128241 9:72744172-72744194 GAAATGGCACTGGGAATGTGTGG - Intronic
1055130776 9:72771675-72771697 TGAAAAACACAGTGAATGTGAGG + Intronic
1055993174 9:82129929-82129951 GTAAATGCAATGTGAATGGGAGG + Intergenic
1059020701 9:110573457-110573479 GTCAGAGGACTGGGAATGTGTGG - Intronic
1060683003 9:125582466-125582488 GTAAAAGCACTGACAGTGAGTGG - Intronic
1061334301 9:129921171-129921193 TTAAAAGAACTCTGCATGTGAGG + Intronic
1188754597 X:33946953-33946975 GTAAAAATACTGTGACTTTGGGG + Intergenic
1194736660 X:97520421-97520443 ACAAAAGCACTGTTATTGTGTGG - Intronic
1195958746 X:110363244-110363266 GACACAGCACTGTGAATTTGTGG + Intronic
1196121486 X:112055902-112055924 GAAAAAGCCCTTTCAATGTGTGG - Intronic
1196263913 X:113619281-113619303 AAAAAAGCACTGTGAGTCTGAGG - Intergenic
1200354162 X:155530742-155530764 GTAAAAACAGTGGGAATCTGTGG + Intronic
1201913848 Y:19160994-19161016 TTCAAAGCAGTGTGAATATGAGG + Intergenic