ID: 975115342

View in Genome Browser
Species Human (GRCh38)
Location 4:70674224-70674246
Sequence CTAGATACTACTCTTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975115342_975115343 7 Left 975115342 4:70674224-70674246 CCTATTTAAAGAGTAGTATCTAG 0: 1
1: 0
2: 1
3: 11
4: 197
Right 975115343 4:70674254-70674276 TTCAATAGTCAAGTGTAATCTGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975115342 Original CRISPR CTAGATACTACTCTTTAAAT AGG (reversed) Intronic
902106842 1:14044442-14044464 CTATATTCTACTCTGTAAAATGG + Intergenic
903869430 1:26422756-26422778 CCAGATATTACAATTTAAATTGG - Intronic
907114395 1:51956166-51956188 TTGGATTCTCCTCTTTAAATAGG + Intronic
909752032 1:79173421-79173443 CTTGATTTTACACTTTAAATGGG - Intergenic
909884404 1:80923056-80923078 CTAGAAACTACTGTTTGCATGGG + Intergenic
910348457 1:86268290-86268312 TTAGATTTTACTCTTAAAATAGG + Intergenic
911952193 1:104188433-104188455 CCAGATATTCCTCTATAAATGGG + Intergenic
916196960 1:162233484-162233506 CTGAATATTACACTTTAAATGGG - Intronic
916779622 1:168010952-168010974 CTAAATCATATTCTTTAAATAGG - Intronic
916789117 1:168109491-168109513 CTAGAACCTACTCTTTATGTAGG - Intronic
917294318 1:173503131-173503153 CTAGCTACAACTCATTAATTTGG - Intronic
917551364 1:176033979-176034001 CTAAATAATACTCTTAAGATGGG + Intronic
921310486 1:213838066-213838088 CTAGTGACTTCTCTTTTAATGGG - Intergenic
922713899 1:227856004-227856026 CTAGATACAAAACTTAAAATGGG + Intergenic
922882874 1:228995508-228995530 CTGAATAATACACTTTAAATGGG + Intergenic
922978967 1:229808948-229808970 TTAGATTGTACACTTTAAATGGG - Intergenic
1064789356 10:18938423-18938445 CTAGAAACTGCTTCTTAAATAGG + Intergenic
1066540844 10:36444920-36444942 ATAGCTACTACTCATTAATTTGG - Intergenic
1071346065 10:84694934-84694956 CTAAATTCTACACTTTAAATAGG + Intergenic
1073873286 10:107890564-107890586 CTACATTGTACACTTTAAATAGG - Intergenic
1077924510 11:6667617-6667639 CTAGAGACTCCTTCTTAAATAGG + Intergenic
1078422230 11:11222026-11222048 TTAGTGACTATTCTTTAAATTGG + Intergenic
1078868353 11:15320246-15320268 CTAAACACTTCTGTTTAAATGGG - Intergenic
1078965940 11:16342651-16342673 ATAAAAACTACTGTTTAAATTGG - Intronic
1079430194 11:20382290-20382312 CTAGATACTAATTTTTCATTTGG + Intronic
1080272991 11:30470563-30470585 CTAAATTATACACTTTAAATGGG + Intronic
1080727752 11:34915391-34915413 CGAGTTACTACTTTTTAATTAGG + Intronic
1083098119 11:60273620-60273642 CTAGACACCACTTCTTAAATAGG - Intergenic
1086234515 11:84611973-84611995 CTAAATTGTACACTTTAAATAGG - Intronic
1086661168 11:89420399-89420421 TTACATTCTGCTCTTTAAATGGG - Intronic
1086998176 11:93383578-93383600 CTGGATTGTACACTTTAAATGGG + Intronic
1087295280 11:96365819-96365841 CTAGATACTACTATTCTAATTGG + Intronic
1088304239 11:108391308-108391330 CTGGATACTATACTTTAAATGGG - Intronic
1089012566 11:115142988-115143010 ATAGAAACTAAGCTTTAAATGGG + Intergenic
1090123592 11:124060141-124060163 CTTGATTCTTCTTTTTAAATTGG + Intergenic
1091324399 11:134674981-134675003 TTAAATTGTACTCTTTAAATGGG + Intergenic
1095362703 12:41363108-41363130 CTAGAGACTAGTCTTTTATTTGG + Intronic
1095719757 12:45387646-45387668 GGAGATACTACTATTTAAAAGGG - Intronic
1096552478 12:52382176-52382198 CTAGATCCCAGTCTTTAAATTGG + Intronic
1096666311 12:53168330-53168352 CTAAATAGTACCCTTTAAGTGGG + Intronic
1096771856 12:53940110-53940132 CTAGACAGTATTTTTTAAATAGG + Intronic
1099904795 12:88759645-88759667 CAAGATTCTTCTCTTAAAATGGG + Intergenic
1101508125 12:105366574-105366596 ATAGATAGTACCATTTAAATTGG + Intronic
1105992290 13:25634358-25634380 CTAAATACTAGCCTTTAAAATGG + Intronic
1106775765 13:33008075-33008097 CTAGAGACTTCTTCTTAAATAGG + Intergenic
1107571717 13:41667282-41667304 CTAGAAAATTCTCTTTAAAAGGG + Intronic
1108956360 13:56163226-56163248 TTAGATTGTACACTTTAAATGGG + Intergenic
1111598247 13:90438333-90438355 CTAAATACCAGTCTTTTAATTGG + Intergenic
1112808621 13:103190780-103190802 ATAGAAACTCCTCTCTAAATAGG - Intergenic
1112977979 13:105344631-105344653 CTAGAAAGTACTATATAAATGGG - Intergenic
1117109391 14:52434205-52434227 CTACATGCTACACTTTAAACTGG - Intronic
1117992286 14:61445860-61445882 GTAGATACAACTCTTTAGTTTGG + Intronic
1118058224 14:62105572-62105594 GTTGATACTACTTTTTAAAATGG + Exonic
1119048928 14:71346726-71346748 CTAAATTGTACACTTTAAATGGG - Intronic
1120486742 14:85123637-85123659 TTAGATACACCTCTTTGAATTGG - Intergenic
1122358449 14:101139310-101139332 CTAGATACTCTTCATTAACTTGG + Intergenic
1125203584 15:37125460-37125482 CTAGATGCTAATCTTTATTTTGG - Intergenic
1125876975 15:43157385-43157407 CTAGGGTCTACTCTTTAAATTGG - Intronic
1127908302 15:63393870-63393892 ATAGATATTTCTCTTTAAAAAGG + Intergenic
1127914197 15:63441949-63441971 AAACATACTTCTCTTTAAATGGG + Intergenic
1128781390 15:70361073-70361095 ACAGATTGTACTCTTTAAATGGG + Intergenic
1130159314 15:81383186-81383208 CTAGATACTTCCTATTAAATGGG + Intergenic
1132122410 15:99188441-99188463 CTACATTGTACACTTTAAATGGG + Intronic
1134327649 16:13221657-13221679 CTGGATTTTACACTTTAAATGGG - Intronic
1136184843 16:28581392-28581414 CTGGATTATACACTTTAAATGGG - Intronic
1137716311 16:50600558-50600580 TTAAATGCTTCTCTTTAAATTGG - Intronic
1138279035 16:55758958-55758980 CTAGATTGTACACTTTAAAAAGG - Intergenic
1138289505 16:55834723-55834745 CTAGATTGTACACTTTAAAAAGG + Intergenic
1139181915 16:64758799-64758821 CGAGATACTACTCTTTAAAATGG + Intergenic
1140578091 16:76196651-76196673 ATAGATTCTACTCCTTATATGGG - Intergenic
1141257634 16:82417571-82417593 TTACATACTGCTCTCTAAATAGG + Intergenic
1144261111 17:13521808-13521830 GTGGATACAACTCTTTAGATAGG + Intronic
1145325762 17:21823160-21823182 CTAGATTCTACTCCTTAGCTTGG + Intergenic
1145818030 17:27809426-27809448 CTGAATTATACTCTTTAAATGGG - Intronic
1154275381 18:12954829-12954851 CTAAATTGTACACTTTAAATGGG - Intronic
1155465671 18:26132964-26132986 CCAGATAATATTCTTTTAATTGG - Intergenic
1156772511 18:40746675-40746697 CTAGATACTGCTCTTTTTCTCGG - Intergenic
1157659644 18:49428831-49428853 CTGAATAATACACTTTAAATGGG + Intronic
1157809235 18:50682188-50682210 CTAAATAGTACACTTTAAAATGG + Intronic
1157944158 18:51959804-51959826 CTAGTTGCTAATCTTTAAACAGG - Intergenic
1159238031 18:65702902-65702924 CTAGAAACTACACATAAAATAGG - Intergenic
1159295962 18:66488920-66488942 GTTGTTACTACTCTTAAAATGGG - Intergenic
1167234391 19:48304976-48304998 CTACATTCTACGCTTTAAAATGG + Intronic
1168004864 19:53478471-53478493 CTACATAGTACTTTTTAAAGGGG + Intronic
927569001 2:24141677-24141699 CTAGATACTAGTTTTTAAAATGG + Intronic
929485916 2:42354205-42354227 CTAAATTGTACCCTTTAAATGGG + Intronic
930349108 2:50226718-50226740 CAAGATACCAATCTATAAATAGG + Intronic
930642997 2:53873510-53873532 TGAGATACTACTTTTTAAGTTGG - Intronic
930843654 2:55877177-55877199 CTATTTATTACTTTTTAAATGGG + Intronic
932945990 2:76232029-76232051 CTGGATTGTACTTTTTAAATGGG - Intergenic
933305054 2:80587168-80587190 CTAGATATTATTATTAAAATGGG + Intronic
933799262 2:85947198-85947220 CTAGACAATACTGTATAAATTGG + Intergenic
936727994 2:115345976-115345998 ATAAAGACAACTCTTTAAATTGG + Intronic
936972953 2:118192218-118192240 CTAGAAGCTACTGTGTAAATGGG + Intergenic
937643940 2:124244660-124244682 CTCTATTTTACTCTTTAAATTGG - Intronic
939278833 2:140036900-140036922 CTAGAGACTCCTTATTAAATAGG - Intergenic
939786216 2:146516544-146516566 ATGGATGCTACTCTTTATATAGG - Intergenic
940863228 2:158791415-158791437 CATGTTATTACTCTTTAAATGGG - Intergenic
942037950 2:172029508-172029530 CTATATACTATTTTGTAAATGGG - Intronic
942229166 2:173843634-173843656 ATAAATACTTCTCTTAAAATCGG - Intergenic
944968141 2:204959799-204959821 CTAGTGCCTAATCTTTAAATTGG + Intronic
945728429 2:213502744-213502766 CTATATACTCCTCTGTAAAATGG - Intronic
946262202 2:218503326-218503348 CCAAATAATACACTTTAAATAGG + Intronic
947407910 2:229799966-229799988 TTATATACTACTATTTAAAGTGG - Intronic
1169656165 20:7925868-7925890 CTAGATTCTAATTTTTTAATAGG + Intronic
1169816600 20:9663504-9663526 CTTAATACTACTATTTAATTTGG + Intronic
1172901773 20:38340342-38340364 CTGGATTGTACACTTTAAATGGG + Intergenic
1175010332 20:55728291-55728313 CTATTTACAACTCTGTAAATTGG + Intergenic
1177851663 21:26356298-26356320 CTAGATAAGAATATTTAAATTGG - Intergenic
1177860334 21:26445102-26445124 GTAGATCCAATTCTTTAAATGGG + Intergenic
1177987508 21:27995593-27995615 CAAGATACTTTTTTTTAAATTGG + Intergenic
949772231 3:7591804-7591826 CTATTTTCTACTCTGTAAATGGG - Intronic
952025476 3:29075726-29075748 CCAGATAGTGCTCTTTATATAGG + Intergenic
952808511 3:37380160-37380182 CTGAATACTCCTGTTTAAATGGG - Intergenic
953293721 3:41691602-41691624 ATAGATAATACTGTTTAAAATGG - Intronic
954281288 3:49580399-49580421 CTGAATTATACTCTTTAAATGGG - Intronic
955130670 3:56164149-56164171 CTAAATTATACTCTTTAAAAGGG - Intronic
955766900 3:62354452-62354474 CTAGACACACCTCATTAAATTGG - Intergenic
956208612 3:66779735-66779757 CTCAATATTATTCTTTAAATTGG + Intergenic
956657771 3:71568548-71568570 ATACTTACTACTTTTTAAATAGG + Intronic
957839675 3:85652161-85652183 CAAGATACTAATCCTTTAATTGG - Intronic
959058170 3:101589288-101589310 CTAAATACTACTTTTTAAAAGGG - Intronic
959391631 3:105782124-105782146 ATAGATACTACTATTGAGATGGG + Intronic
964328184 3:155571388-155571410 CTAGATATTTCTTTTGAAATCGG + Intronic
965078757 3:164010749-164010771 CTAGATACTATTCTTGGCATTGG + Intergenic
965420702 3:168455022-168455044 CTACATACCACTCTTTGTATTGG - Intergenic
966959441 3:184919146-184919168 GTAGTTACTGTTCTTTAAATGGG - Intronic
968262736 3:197338274-197338296 CTAAAAACTACTCTCTTAATGGG + Intergenic
971612571 4:28744491-28744513 CCAGATACTACCCTTTCATTTGG - Intergenic
971850644 4:31981994-31982016 CTTGATACCACACTTTAATTTGG - Intergenic
974680321 4:65152468-65152490 CTAGATGCTTCTTTTTATATAGG + Intergenic
975115342 4:70674224-70674246 CTAGATACTACTCTTTAAATAGG - Intronic
978610410 4:110532161-110532183 CTGGATTGTACACTTTAAATAGG - Intronic
978981265 4:114948952-114948974 CTAAATATGACTATTTAAATTGG - Intronic
980004677 4:127528197-127528219 GGAGATACTGCTTTTTAAATGGG - Intergenic
980220820 4:129911524-129911546 CTAAATTGTACTCTTTAAAAGGG + Intergenic
980488951 4:133499719-133499741 TGAGAAACTACACTTTAAATGGG - Intergenic
981863430 4:149384445-149384467 CTAGATACTACTCTTGTCACTGG + Intergenic
982024843 4:151241693-151241715 CTAAATTGTACACTTTAAATGGG + Intronic
982812415 4:159842828-159842850 CTGAATTCTACACTTTAAATGGG - Intergenic
983397457 4:167218322-167218344 CTAGTTGCTACTCTTGAACTAGG - Intronic
986426817 5:7640298-7640320 CCAGATTCTACCCTTTAAAGAGG + Intronic
986497550 5:8360841-8360863 CTAGATAAAACTCTTCACATAGG + Intergenic
986942077 5:12966109-12966131 CAAAATACTACTTTTTAAATTGG - Intergenic
986986235 5:13503739-13503761 CTATATACTACTCTATATTTGGG + Intergenic
987792899 5:22591396-22591418 CTAGATAATATTTTTTAAAATGG + Intronic
988312558 5:29580138-29580160 CTGGATTATACACTTTAAATGGG - Intergenic
991376600 5:65974549-65974571 ATAGTTACTACTCCTTATATTGG + Intronic
994152228 5:96460903-96460925 CTAAATAATACACTTTAAAGTGG - Intergenic
994852459 5:105073372-105073394 TTAGATACTAGTTTTTAAGTAGG + Intergenic
994867541 5:105295967-105295989 CTAGATATTATTTCTTAAATAGG - Intergenic
994931781 5:106197404-106197426 CTGGATACAAAACTTTAAATTGG - Intergenic
995625420 5:114070958-114070980 CTGAATAGTATTCTTTAAATTGG + Intergenic
995767182 5:115631412-115631434 CTATTTCCTATTCTTTAAATAGG + Intronic
998802605 5:145885482-145885504 CTTGATCCTACACTTTAGATGGG - Intergenic
998811896 5:145974928-145974950 CTAGATTCTATTTTTTTAATTGG - Intronic
1004135152 6:12958872-12958894 ATAGAAACAACTCTTTAAAGAGG + Intronic
1004158578 6:13193019-13193041 CTAACTGCTACTCTTTAAAGGGG - Intronic
1004654148 6:17642011-17642033 TTACCTACTACTTTTTAAATTGG - Intronic
1007899207 6:45394449-45394471 CTAGAGACTCCTTTTTAAGTAGG + Intronic
1008623244 6:53292851-53292873 TTAAATACTGCCCTTTAAATAGG - Intronic
1009856024 6:69265043-69265065 CTAGATAATAACCTTTAGATAGG + Intronic
1010090572 6:71975609-71975631 CTAAATTGTACTCTTTAAAAAGG - Intronic
1010847173 6:80722986-80723008 CTAGATACTACTCTATTATATGG + Intergenic
1011351584 6:86429720-86429742 CTGGATTATACACTTTAAATGGG + Intergenic
1012718528 6:102709677-102709699 CTAGATACTACATCTTATATAGG - Intergenic
1012850563 6:104441983-104442005 CTAAATTCTTCTCTTTATATAGG + Intergenic
1013144949 6:107380178-107380200 CTAGAAACTCCTTCTTAAATAGG + Intronic
1013988604 6:116226925-116226947 CTAAATGATACTATTTAAATAGG + Intronic
1016413728 6:143811298-143811320 CTATATCCTACTGTTTAATTTGG + Intronic
1017865153 6:158436517-158436539 CTATAGAATATTCTTTAAATAGG - Intronic
1018238116 6:161745634-161745656 CTATATTCTAGCCTTTAAATAGG - Intronic
1021894360 7:25220214-25220236 CTGGATGGTGCTCTTTAAATAGG + Intergenic
1021999530 7:26212791-26212813 CTAGATAGGACAATTTAAATTGG + Exonic
1024300294 7:47882357-47882379 CCAGGTACTACTCTAGAAATAGG + Intronic
1024725879 7:52193977-52193999 CTATATACCACTTTTAAAATGGG + Intergenic
1031352321 7:120749618-120749640 CTAGAAACTATTCTAGAAATGGG - Exonic
1031579640 7:123456035-123456057 ATATAAACTACTCTTTAACTGGG + Intronic
1031710606 7:125041569-125041591 CTAGATACTTTTATTTACATTGG - Intergenic
1039172840 8:34767880-34767902 CTTAATACAAGTCTTTAAATTGG + Intergenic
1039942580 8:42103853-42103875 CTAGCCACCACTCTTTAAACAGG + Intergenic
1041393749 8:57371468-57371490 ATATATACTCCTTTTTAAATTGG - Intergenic
1042094747 8:65201562-65201584 CTAAATTGTACACTTTAAATGGG - Intergenic
1042194085 8:66216911-66216933 CTAGATACTTGTCTTTCAAATGG - Intergenic
1044860304 8:96516457-96516479 CTAAAAACTACGCTTTAAATGGG - Intronic
1044977211 8:97676383-97676405 ATAGATTATACTCCTTAAATTGG + Intronic
1046156756 8:110301118-110301140 TTAGGTTCTACTCTTAAAATTGG + Intergenic
1046847118 8:118930215-118930237 CTACATCCTACTCCTTAAATGGG + Intronic
1046974684 8:120261305-120261327 TTAGTTTCTTCTCTTTAAATTGG + Intronic
1049078779 8:140424093-140424115 CTGGATTTTACCCTTTAAATAGG + Intronic
1051066334 9:13108029-13108051 GTAGGTACAACACTTTAAATTGG + Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1053586102 9:39460664-39460686 CTGAATTCTACACTTTAAATGGG + Intergenic
1054580207 9:66904566-66904588 CTGAATTCTACACTTTAAATGGG - Intronic
1055148906 9:72971064-72971086 CTAAGTAATACTATTTAAATTGG - Intronic
1058020735 9:100084856-100084878 CTAGATACTACTGTAGAAAGGGG + Intronic
1059868224 9:118541172-118541194 CTGCATACTACTCTGAAAATGGG - Intergenic
1186998883 X:15154629-15154651 CTGGATTCTATGCTTTAAATGGG + Intergenic
1188411114 X:29873168-29873190 CCAGACAGTACCCTTTAAATAGG + Intronic
1189579808 X:42394176-42394198 GTAGATACAAGTCTTTCAATGGG + Intergenic
1192443255 X:71190811-71190833 CTAGCTACAACTCTCTAAATTGG + Intergenic
1193762335 X:85482863-85482885 CTAAATCATACTCTTTAAAATGG - Intergenic
1194466577 X:94241136-94241158 TTAAATAGTACACTTTAAATGGG + Intergenic
1194616199 X:96106600-96106622 CTAGAAACTTCTATTCAAATTGG - Intergenic
1195031847 X:100933914-100933936 CTAAATTGTACACTTTAAATGGG - Intergenic
1196102879 X:111865876-111865898 CTAGGAACTACTCTTAACATTGG + Intronic
1196482917 X:116171136-116171158 TTAGATATTACACTTTTAATTGG + Intronic
1198762046 X:140042485-140042507 CCAGATTGTACACTTTAAATGGG - Intergenic
1199296297 X:146162638-146162660 CTACATACTGCTGTGTAAATGGG - Intergenic
1200877412 Y:8172478-8172500 CTAGAAACTAATGTTTAATTAGG + Intergenic