ID: 975116136

View in Genome Browser
Species Human (GRCh38)
Location 4:70683245-70683267
Sequence ATTTAATCTAGTGTCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975116134_975116136 -4 Left 975116134 4:70683226-70683248 CCAGCCAAGAAAGATTACTATTT 0: 1
1: 0
2: 1
3: 18
4: 319
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
975116131_975116136 3 Left 975116131 4:70683219-70683241 CCCCACTCCAGCCAAGAAAGATT 0: 1
1: 0
2: 1
3: 15
4: 218
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
975116132_975116136 2 Left 975116132 4:70683220-70683242 CCCACTCCAGCCAAGAAAGATTA 0: 1
1: 0
2: 1
3: 16
4: 199
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
975116130_975116136 13 Left 975116130 4:70683209-70683231 CCTTCTCACACCCCACTCCAGCC 0: 1
1: 1
2: 16
3: 121
4: 980
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
975116133_975116136 1 Left 975116133 4:70683221-70683243 CCACTCCAGCCAAGAAAGATTAC 0: 1
1: 0
2: 3
3: 8
4: 120
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
975116135_975116136 -8 Left 975116135 4:70683230-70683252 CCAAGAAAGATTACTATTTAATC 0: 1
1: 0
2: 1
3: 19
4: 277
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188
975116129_975116136 19 Left 975116129 4:70683203-70683225 CCACTACCTTCTCACACCCCACT 0: 1
1: 0
2: 5
3: 40
4: 475
Right 975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG 0: 1
1: 0
2: 0
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975116136 Original CRISPR ATTTAATCTAGTGTCTATCT TGG Intronic
901278009 1:8008178-8008200 TTTTAAGCTAGTCTCTATTTTGG - Intronic
905925660 1:41747826-41747848 CTTTAAAATAGTGTCTTTCTGGG + Intronic
909153124 1:72034421-72034443 AATTAATTTGGTGTCTAACTCGG + Intronic
910384713 1:86668693-86668715 ATTTAATCCAGTGTTTTTTTTGG - Intergenic
910672013 1:89783223-89783245 TTTTATTCCAGTGGCTATCTTGG + Intronic
910833790 1:91486934-91486956 ATATAAGATAGTGTCTGTCTGGG - Intergenic
911641357 1:100292921-100292943 ATTAAAACTTGGGTCTATCTTGG + Intergenic
911846857 1:102764305-102764327 ATTTATTTTTCTGTCTATCTTGG - Intergenic
914699773 1:150121415-150121437 AGTTAGTCTAGTGTGTCTCTGGG + Intronic
917619166 1:176778167-176778189 ATTTAATAAAGTTTCTATTTTGG - Intronic
918882962 1:190150439-190150461 ATTTAATCTAATGACTAATTTGG - Intronic
921739105 1:218663585-218663607 ATTTAATCAAGTGCCTGTCTGGG - Intergenic
921819502 1:219601185-219601207 ACTTATTCAACTGTCTATCTGGG - Intergenic
1065507509 10:26444101-26444123 AGTTAACCAAGTGGCTATCTGGG + Intronic
1066787591 10:39022733-39022755 CTTCATTCTAGTTTCTATCTGGG + Intergenic
1066797032 10:39133688-39133710 CTTCATTCTAGTTTCTATCTGGG - Intergenic
1066807960 10:39282327-39282349 ATTTTGTCTAGTTTTTATCTTGG + Intergenic
1068977731 10:63029480-63029502 TATTTATCAAGTGTCTATCTAGG + Intergenic
1073727344 10:106248458-106248480 ATTAATTCTAAAGTCTATCTGGG + Intergenic
1074321940 10:112411374-112411396 ATTGAATCTAGTTTCTTTCAAGG + Intronic
1079194189 11:18310640-18310662 ATTTTATCTACTGTATTTCTTGG - Intronic
1081319306 11:41671352-41671374 ATTTAATATAGTTGCTATCTCGG + Intergenic
1081723486 11:45307192-45307214 ATTTAATACAGTGGGTATCTGGG + Intergenic
1082148724 11:48704689-48704711 ATTTCTTCTAGTATTTATCTGGG + Intergenic
1082268980 11:50149175-50149197 ATTTTATCCAGTGCCTGTCTTGG + Intergenic
1086587663 11:88474321-88474343 ATTTAATCAAGTAACTCTCTGGG + Intergenic
1087114477 11:94510203-94510225 ATTTCTTCTTGTGTCTATTTTGG + Intergenic
1090987466 11:131782323-131782345 ATTTATTCTTGTGACTATTTTGG - Intronic
1093484371 12:19637574-19637596 ATTTAATTTATTTTCTTTCTGGG + Intronic
1093581695 12:20790882-20790904 ATGTCAGCTAGTGTCTACCTAGG + Intergenic
1094439750 12:30461923-30461945 ATTTTATGTTGTGTCTTTCTAGG - Intergenic
1095655362 12:44662284-44662306 ATTTAAACTACTGTCTTTATAGG - Intronic
1096048874 12:48588325-48588347 ATTTTTTATAGTATCTATCTGGG - Intergenic
1098907891 12:76180385-76180407 ACTTAAGCTAGTCTCTAGCTGGG + Intergenic
1101171184 12:102096501-102096523 TTATAATATAGTGTCTTTCTTGG + Intronic
1103570796 12:121843567-121843589 ATTTATTCTAGGGTCTATGTGGG - Intronic
1106724716 13:32471985-32472007 ATTTAATCAAGCCTCTCTCTAGG + Intronic
1107474554 13:40722773-40722795 ATGTAATCTAGTCTCTAATTAGG + Intergenic
1107663385 13:42663370-42663392 ATTTAATCAAATGTGAATCTAGG + Intergenic
1107891460 13:44918246-44918268 ATCCAATCTAGTGTCTACATTGG - Intergenic
1109750087 13:66680166-66680188 GTTTTATATTGTGTCTATCTTGG + Intronic
1113033505 13:106021565-106021587 ATTTTATCTAGTGTGTAGTTTGG - Intergenic
1114725173 14:24928935-24928957 TTTTAATCTAGTGCCTGTGTTGG - Intronic
1115082696 14:29476489-29476511 TTTTTATCTAGAGTCTATATAGG + Intergenic
1115275041 14:31598881-31598903 AGTTAATGTTGTGTCTTTCTGGG + Intronic
1116321416 14:43469601-43469623 ATTTAATCTATCTTCTATTTGGG + Intergenic
1119353138 14:73982793-73982815 ATTTAAAGTACTTTCTATCTAGG - Intronic
1120399558 14:84011851-84011873 ATTAAATCTAGTCTCCATCTTGG - Intergenic
1123950856 15:25273188-25273210 ATTTATTATAATGTCTTTCTTGG + Intergenic
1126508226 15:49433611-49433633 ATTTGATTTAATGTCTTTCTAGG + Intronic
1129583206 15:76833979-76834001 ATTTGATCAAGTGTCAATTTAGG - Intronic
1131625769 15:94119020-94119042 ATTTAATTTTTTGTCTATATTGG - Intergenic
1132105997 15:99063037-99063059 CTTTAATCTAATGTGTGTCTGGG - Intergenic
1136738503 16:32488073-32488095 ATTTATTCTAGTTTTTATCCTGG - Intergenic
1140190845 16:72814803-72814825 GGTTCATCTAGTTTCTATCTAGG + Intronic
1203014710 16_KI270728v1_random:343719-343741 ATTTATTCTAGTTTTTATCCTGG + Intergenic
1203033045 16_KI270728v1_random:616878-616900 ATTTATTCTAGTTTTTATCCTGG + Intergenic
1146961041 17:36979374-36979396 ATTTAATCAAACGTCTTTCTTGG + Intronic
1147293341 17:39461499-39461521 GTTTAATCTAGTGTGTGACTGGG + Intronic
1149630146 17:58115669-58115691 AATGAATTTAGTGTTTATCTAGG - Intergenic
1151855469 17:76718445-76718467 ATTGAATCCATTTTCTATCTTGG - Intronic
1152011412 17:77721005-77721027 ATTAAATCTATTTTCTATCCAGG - Intergenic
1152326537 17:79644136-79644158 ATTTCATCTTGTGTCAATTTTGG - Intergenic
1153076073 18:1163394-1163416 ATTTAGTCTAATGTCCATTTGGG - Intergenic
1155739337 18:29267660-29267682 ATTTCATCAAGTGTTTTTCTGGG - Intergenic
1156824695 18:41416764-41416786 ATTTTATCTATAGTTTATCTTGG - Intergenic
1158314528 18:56196111-56196133 ATTTAGTCTTGTGTCTGTCATGG + Intergenic
1159772534 18:72563392-72563414 ATTTAAACTAGTCTGTCTCTAGG + Intronic
1164331091 19:24257367-24257389 CTTTTTTCTAGTGTATATCTGGG + Intergenic
1164332562 19:24273624-24273646 GTTTATTCTAGTTTTTATCTGGG + Intergenic
1164333076 19:24279509-24279531 CTTTTTTCTAGTGTTTATCTGGG + Intergenic
1164362174 19:27525703-27525725 CTTTTTTCTAGTGTTTATCTGGG - Intergenic
929422205 2:41803979-41804001 ATTCAAACTAGTGTCTTTCCAGG + Intergenic
930164331 2:48189429-48189451 ATTAGATCTAATGTATATCTTGG + Intergenic
931030010 2:58163517-58163539 ATTTAATCTTGTTTCATTCTAGG - Exonic
932657210 2:73620420-73620442 TTTTACTCTAGTGTCTATGCAGG - Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
940645202 2:156384930-156384952 ATCCAATTTAGTGTGTATCTGGG - Intergenic
941265558 2:163357268-163357290 ATTTAATTTAGTTTCTGTATTGG - Intergenic
941320107 2:164044061-164044083 ATTTAATTTTGTTTCTCTCTGGG - Intergenic
941699894 2:168593020-168593042 GTTTAATCTAGAGTCCACCTGGG + Intronic
942128587 2:172853337-172853359 ATTTCATCTTGTGTCAATTTTGG + Intronic
942883915 2:180899070-180899092 ATTTATTTTAGTGTATATATGGG - Intergenic
942985873 2:182141236-182141258 ATTTAAAATAGAATCTATCTGGG - Exonic
943251860 2:185532671-185532693 ATTTAAGCCAGATTCTATCTTGG - Intergenic
945895376 2:215475321-215475343 TTTCAGTCTAGTGTCTTTCTGGG - Intergenic
1174422895 20:50411883-50411905 GTGTGATCTAGTGTCAATCTGGG + Intergenic
1174775130 20:53336339-53336361 ATTTAATCTGCTGTGTATTTTGG - Intronic
1176859281 21:13997299-13997321 ATTAAAACTTGTGTCTATCAAGG - Intergenic
1179062682 21:37994311-37994333 GTTTAATCCTGTGTCCATCTGGG + Intronic
1184825001 22:46944011-46944033 ATTTAGTATAGTTTCTATGTGGG + Intronic
949278120 3:2311686-2311708 ATTTAATCTACTGTCTGTATAGG + Intronic
951764964 3:26187525-26187547 ATTGAATAAAGAGTCTATCTAGG - Intergenic
955199894 3:56841995-56842017 ACTTAAGCTAGTGTCTATAAAGG - Intronic
957059228 3:75468303-75468325 ATTTAGTCCAGAGTCAATCTGGG + Intergenic
957411199 3:79842713-79842735 GTTTAATATAATGCCTATCTGGG - Intergenic
960850949 3:122053106-122053128 AGTTAAGTTAGTGTCTCTCTGGG + Intergenic
961510661 3:127401147-127401169 ACATAATCTTCTGTCTATCTGGG - Intergenic
966457318 3:180132522-180132544 AATGAATCTATTGTCTATCTTGG + Intergenic
969079856 4:4609977-4609999 ATTTTATCTAGTGGCTCACTGGG - Intergenic
971701999 4:29990217-29990239 AGTTAATCTAGTGTCTGTAAAGG - Intergenic
974970455 4:68818956-68818978 ATTTAATCCATTGAATATCTTGG - Intronic
974985334 4:69017439-69017461 ATTTAATCCATTGAATATCTTGG + Intronic
974999965 4:69211771-69211793 ATTTAATCCATTGAATATCTTGG + Intronic
975005803 4:69283436-69283458 ATTTAATCCATTGAATATCTTGG - Intronic
975014212 4:69392393-69392415 ATTTAATCCATTGAATATCTTGG - Intronic
975015469 4:69411779-69411801 ATTTAATCCATTGAATATCTTGG - Intronic
975116136 4:70683245-70683267 ATTTAATCTAGTGTCTATCTTGG + Intronic
975590750 4:75997413-75997435 ATTTCATCTCCTGTCTATATAGG + Intergenic
975817843 4:78237705-78237727 ATTTATTCTAATCTCTACCTGGG + Intronic
977011095 4:91634215-91634237 ATTTAATATAGTCACTATCAAGG - Intergenic
977979106 4:103302214-103302236 ATTTAAATTAGAGTCTCTCTTGG + Intergenic
978458117 4:108918216-108918238 ATTTAATCATGTGTCTCTTTAGG - Exonic
979274351 4:118798811-118798833 ATTTACCCTAGTGGGTATCTGGG + Intronic
979713654 4:123810605-123810627 AAATTATCAAGTGTCTATCTGGG + Intergenic
981292947 4:143097680-143097702 ATGTAATCTAGTGTATATGTTGG - Intergenic
982236720 4:153258010-153258032 CTTTATTTTAGTGTGTATCTTGG + Intronic
982975645 4:162056266-162056288 ATTGATTCTAGTTTCTTTCTTGG - Intronic
984511471 4:180684093-180684115 ATTTGACCTACTGTCTTTCTTGG - Intergenic
988165436 5:27583176-27583198 ATTTAATCTAGTGTTTCTTCAGG - Intergenic
989844424 5:46122944-46122966 ATTTATTCTAGTTTTTATCCTGG + Intergenic
992257570 5:74936286-74936308 ATTTAATCTACAGACTAACTTGG + Intergenic
992578161 5:78141419-78141441 AATTAATTTAATGTATATCTAGG + Intronic
994108761 5:95976628-95976650 AGGTAATCTAGTGTGTATCCTGG - Intergenic
994174355 5:96694961-96694983 ATTTAATGAAGTGTTTTTCTAGG + Intronic
994401411 5:99285058-99285080 ATTTAATTTATTGTCTAACCTGG + Intergenic
994491314 5:100447718-100447740 ATTTAATCTAATTTCTTTATAGG + Intergenic
994850366 5:105047318-105047340 ATTTAATACAGTGTCTGTCAGGG + Intergenic
994896575 5:105711792-105711814 ATTTAATCAAATGCCAATCTAGG + Intergenic
995952618 5:117734172-117734194 CTTTAATCTAGTTTTTATCCTGG + Intergenic
996343651 5:122466576-122466598 ATTGAATCTAGTTTGTATCAAGG - Intergenic
998229241 5:140349135-140349157 ATAAAATCCAGTGTCTACCTTGG - Intergenic
998796433 5:145824537-145824559 TTCTAATCTAGTGTCTTTTTGGG - Intronic
1000450078 5:161374598-161374620 ATTTAATTTAGTTTCTTCCTAGG + Intronic
1000504506 5:162098346-162098368 AATTAATTTGTTGTCTATCTTGG + Intronic
1001127635 5:169034666-169034688 ATTTGATCTAGCGTCTAGCTGGG - Intronic
1001367246 5:171154612-171154634 ATTTAATATAGTGTTTACTTTGG + Intronic
1001460663 5:171910402-171910424 TTATAATTTAGTATCTATCTAGG - Intronic
1001733139 5:173974694-173974716 TTTAAATCTAGTGTTTATTTTGG - Intronic
1007486345 6:42183490-42183512 TTTTAATCTAGTTTCTATATTGG + Intergenic
1008825804 6:55692247-55692269 ATTCAAACAAGTGTCTATTTCGG + Intergenic
1009566146 6:65313405-65313427 ACTTATTCAACTGTCTATCTGGG + Intronic
1009788998 6:68375918-68375940 TTTTAATCTATTGTCTATTTAGG + Intergenic
1010880405 6:81161855-81161877 ATTTTATCTAATGTATATTTTGG - Intergenic
1010886720 6:81252164-81252186 AGTTAATAATGTGTCTATCTTGG + Intergenic
1012167627 6:95978004-95978026 ATTTATTATATTCTCTATCTTGG + Intergenic
1012565114 6:100639367-100639389 ACTAAATCTAGTTTCTTTCTAGG - Intronic
1013967688 6:115974254-115974276 ATTTACTTTAGTCTCTAGCTTGG - Intronic
1014107167 6:117579738-117579760 CTTTAATCTACTGGCTAGCTGGG - Intronic
1014641446 6:123915619-123915641 ATTTTCTCTCGTGTATATCTTGG - Intronic
1015486971 6:133782920-133782942 ATTTCTTCTAGTGTCAATTTTGG + Intergenic
1017381216 6:153832498-153832520 ATGTAATTCAGTTTCTATCTTGG - Intergenic
1017642592 6:156508870-156508892 ATTGAAACTAATGTCTATTTTGG - Intergenic
1018334818 6:162775661-162775683 ATGTTTTCTAGTGTCTATCATGG + Intronic
1022359717 7:29646398-29646420 ATCTAATGAACTGTCTATCTGGG - Intergenic
1022621966 7:31993685-31993707 ATTTAATCTTTTGTTTATGTTGG - Intronic
1025529132 7:61855001-61855023 ATTTCATCTAGTTTTTATCCTGG + Intergenic
1025532869 7:61911922-61911944 ATTTTTTCTAGTTTTTATCTGGG - Intergenic
1026239922 7:68564421-68564443 ATTTAATGTCCTGTCTCTCTTGG - Intergenic
1028628172 7:92901181-92901203 ATTGAATGTGGTGTCTAGCTAGG - Intergenic
1028814200 7:95125856-95125878 CTTTAATCTATTGTATATGTTGG - Intronic
1028890394 7:95980977-95980999 ATTTAATCTAATGTTTTTCCTGG + Intronic
1030233683 7:107235275-107235297 ATTTATTCTTGTGTGTATCCGGG - Intronic
1030957658 7:115874937-115874959 ATTTAACTTTGTGTCTTTCTAGG - Intergenic
1033073725 7:138228604-138228626 ATTTATTTTGGTGTCTATTTTGG - Intergenic
1033942729 7:146676337-146676359 AATTAATGGAGTGTTTATCTGGG + Intronic
1034568728 7:151937219-151937241 ATGTAATATAGTCTCTCTCTGGG - Intergenic
1037205803 8:16319160-16319182 ATTTAGTCTAGTTTCAATGTTGG - Intronic
1040127213 8:43751392-43751414 ATTTTTTCTAGTTTATATCTGGG - Intergenic
1040131284 8:43799832-43799854 CTTTTTTCTAGTGTTTATCTGGG - Intergenic
1040134188 8:43833433-43833455 ATTAATTCTAGTTTTTATCTTGG - Intergenic
1040137688 8:43874320-43874342 CTTTATTCTAGTTTTTATCTGGG - Intergenic
1040274310 8:45998146-45998168 CTTTTTTCTAGTGTTTATCTGGG - Intergenic
1040281180 8:46045878-46045900 ATTTTTTCTAGTTTTTATCTAGG - Intergenic
1040281221 8:46046735-46046757 ATTTTTTCTAGTTTTTATCTAGG - Intergenic
1042974217 8:74447366-74447388 ATTTTTTCTACTGTATATCTGGG + Intronic
1043694151 8:83199374-83199396 AATTAATGTAGTGTCTACATAGG + Intergenic
1043871218 8:85435308-85435330 ATTTCATCTAATTTCTCTCTGGG - Intronic
1044062457 8:87654821-87654843 ATTGAATCTAAACTCTATCTGGG + Intergenic
1045403947 8:101846579-101846601 AGATTATCTAGTGCCTATCTTGG + Intronic
1045768438 8:105705210-105705232 ATTTAATGTAGTGTATATTTAGG + Intronic
1046818397 8:118610214-118610236 TTTTAATAAAGTGTGTATCTTGG - Intronic
1050619178 9:7434612-7434634 AGTTAATCTATTCTCAATCTGGG + Intergenic
1051373998 9:16385909-16385931 TTTTAATCTATTTTCTATATAGG + Intergenic
1051848032 9:21474831-21474853 ATTTCATCTAGCCTCTTTCTCGG + Intergenic
1052887109 9:33660352-33660374 ATTTTATCTCTTGTCTTTCTTGG + Intergenic
1055136342 9:72833445-72833467 ATTTCAACTAGTGTGTGTCTGGG + Intronic
1058812829 9:108657862-108657884 ATTTAATCCACTGTGTATTTGGG + Intergenic
1061473389 9:130845156-130845178 ATTTAATCTACTGCCTATAATGG - Intronic
1187353253 X:18542087-18542109 ATTTAATCTCCTGTTTTTCTTGG + Intronic
1191577488 X:62722509-62722531 TTTTTATCTAGTTTTTATCTAGG + Intergenic
1191582990 X:62786141-62786163 CTTCATTCTAGTGTTTATCTGGG + Intergenic
1194266896 X:91765130-91765152 ATTTAAATTAGTGTTTATTTTGG - Intergenic
1194499498 X:94662813-94662835 ACTTATTCTAGTGAATATCTTGG + Intergenic
1195215261 X:102693476-102693498 ATTTAACCCAGTGTCTAGCATGG - Intergenic
1199504908 X:148550961-148550983 CTGTTATCTAGTGTGTATCTAGG - Intronic
1200754757 Y:6980244-6980266 TTTTATTCTACTTTCTATCTAGG + Intronic
1201779536 Y:17703925-17703947 CTTTATTCTAGTTTTTATCTGGG + Intergenic
1201822020 Y:18202067-18202089 CTTTATTCTAGTTTTTATCTGGG - Intergenic
1201915923 Y:19181164-19181186 ATTTTATCTCGTGTCTCTCATGG + Intergenic