ID: 975126963

View in Genome Browser
Species Human (GRCh38)
Location 4:70793830-70793852
Sequence CAAAGTCCTGTTTGAAGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975126963_975126968 30 Left 975126963 4:70793830-70793852 CCGGCTCTTCAAACAGGACTTTG 0: 2
1: 0
2: 1
3: 13
4: 179
Right 975126968 4:70793883-70793905 TCGAGGAGCTCACCAGGCAGCGG 0: 1
1: 0
2: 0
3: 17
4: 187
975126963_975126967 24 Left 975126963 4:70793830-70793852 CCGGCTCTTCAAACAGGACTTTG 0: 2
1: 0
2: 1
3: 13
4: 179
Right 975126967 4:70793877-70793899 TGGAAGTCGAGGAGCTCACCAGG 0: 1
1: 0
2: 1
3: 27
4: 132
975126963_975126966 13 Left 975126963 4:70793830-70793852 CCGGCTCTTCAAACAGGACTTTG 0: 2
1: 0
2: 1
3: 13
4: 179
Right 975126966 4:70793866-70793888 CAGTCTGCAGCTGGAAGTCGAGG 0: 1
1: 0
2: 1
3: 13
4: 177
975126963_975126965 4 Left 975126963 4:70793830-70793852 CCGGCTCTTCAAACAGGACTTTG 0: 2
1: 0
2: 1
3: 13
4: 179
Right 975126965 4:70793857-70793879 CAAGATCAACAGTCTGCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975126963 Original CRISPR CAAAGTCCTGTTTGAAGAGC CGG (reversed) Exonic
900302550 1:1985438-1985460 CAGACGCCTGTTTGCAGAGCTGG - Exonic
902136654 1:14312034-14312056 GAAAGACATGTTTGGAGAGCTGG + Intergenic
904508693 1:30982539-30982561 AAAAATCCTGTAGGAAGAGCAGG - Intronic
909103135 1:71376175-71376197 TATAGTCCAGTTTGAAGAGGTGG + Intergenic
910683920 1:89896572-89896594 CAAGCTCCTGTGTGAAGATCAGG + Intronic
912126841 1:106549915-106549937 CAAAGTCTTCTTTGGAGAGAGGG + Intergenic
912841288 1:113041801-113041823 CAAAGGCCTGTGGAAAGAGCTGG - Intergenic
914771203 1:150686848-150686870 CAAAGACCTGTTTTAATAGTAGG - Intronic
916282414 1:163066463-163066485 GAAAGCCCTCTTTGAAGAGGTGG - Intergenic
916964523 1:169922589-169922611 CAAAGTCCTTTTTAAAGGTCAGG + Intronic
917566915 1:176222194-176222216 AAAAGTCCAGTTTGAGGAGCAGG + Intergenic
918848900 1:189657515-189657537 CAAATTTTTGTTTGAAGAGTAGG - Intergenic
919615893 1:199808252-199808274 CAAAGTGCTGTCTGATGAGCAGG - Intergenic
920552392 1:206873561-206873583 CAAGGCCCAGTTTGCAGAGCAGG - Intergenic
924087760 1:240471072-240471094 CAAAGTCCTGTATGAAGTTCTGG - Intronic
924193257 1:241578294-241578316 CAGAGTCATGTTTGCAGTGCTGG - Intronic
1063082218 10:2778963-2778985 AAAAGTCCTGGTTGAAGAGAAGG - Intergenic
1066755898 10:38713014-38713036 CAGAGTCCTGTGAGAAGACCAGG - Intergenic
1068597716 10:58921272-58921294 CAAATTCATCTTTTAAGAGCAGG + Intergenic
1070145197 10:73768907-73768929 GTCAGTCCTGATTGAAGAGCAGG + Intronic
1070440375 10:76436953-76436975 AGAAGTCCTGTTTGAGGAGTGGG - Intronic
1071360818 10:84844329-84844351 CAAAGGCCTGCTTGATGAGGTGG - Intergenic
1077104951 11:838117-838139 CAAAGACCTGTGTGCAGAGCCGG - Exonic
1078476144 11:11632205-11632227 CAAAATACTGTCTGAAGAGTGGG - Intergenic
1078918829 11:15807788-15807810 TAAAGTCCAGCTTTAAGAGCTGG + Intergenic
1079345437 11:19647619-19647641 CCAAGTCCAGGTTCAAGAGCTGG - Intronic
1080722489 11:34863381-34863403 GTAAGTCCTGTTTGATGAGCTGG - Intronic
1080994118 11:37579777-37579799 TAAAGCCCTGTTGCAAGAGCAGG + Intergenic
1081610571 11:44560653-44560675 CAAGGCCCTGGTTCAAGAGCAGG - Intergenic
1081771017 11:45650671-45650693 CCAGGTGCTGGTTGAAGAGCTGG + Exonic
1084032271 11:66487934-66487956 CATCGACCTCTTTGAAGAGCCGG - Exonic
1084403648 11:68959046-68959068 CAAAGGCCTCTCTGAAGAGGTGG + Intergenic
1084456967 11:69273491-69273513 CAAAGTCCTGCAGGAAGGGCTGG - Intergenic
1085083987 11:73654834-73654856 CAAAGTCCAGTTGGAAGAAATGG + Intronic
1090124477 11:124071480-124071502 CGGAGTCCTGTTTCAAGAGCGGG - Intergenic
1090649135 11:128791237-128791259 CCAAGTCATGTTTGAAGGACAGG - Intronic
1094073796 12:26450354-26450376 CAAATTCCTTTTTTAAGAGAAGG - Intronic
1096421270 12:51459998-51460020 CAATGTCCTGGTTGGAGAGGTGG + Exonic
1098065678 12:66613713-66613735 GAGAGTTCTGTTTGGAGAGCTGG + Intronic
1100270390 12:93019079-93019101 CAATGGCCTGCTTGAAGAGAGGG - Intergenic
1100353617 12:93808318-93808340 CAAAGTCATGTTTTAATTGCTGG + Intronic
1100464682 12:94834593-94834615 CAAAGGCCTGAAGGAAGAGCTGG + Intergenic
1102832610 12:116019117-116019139 GAAATTCCTGTTGGAAGAGATGG - Intronic
1102956826 12:117064379-117064401 CAAATGCCTCTTTGAAAAGCTGG + Intronic
1104977693 12:132559661-132559683 CAAAGTGCTGTTTCAGGCGCCGG + Intronic
1105535601 13:21261178-21261200 CAGAGTCCTGGATGAAGAGGGGG + Intergenic
1108563476 13:51670559-51670581 CAAATGCCTGTTTGAAGGGGTGG + Intronic
1110700800 13:78545828-78545850 CAAAGGACTATTTGAATAGCTGG - Intergenic
1111760802 13:92461920-92461942 CAAAGACCTGTGTGAAGTGAGGG + Intronic
1111932287 13:94524511-94524533 CAGAGTCCTGTCTGAGGAGGTGG + Intergenic
1116859028 14:49979025-49979047 CAAAGGGGTGTCTGAAGAGCTGG - Intergenic
1119174912 14:72561916-72561938 CAGAGTCCTGTTTGGAATGCAGG - Intronic
1119373544 14:74168690-74168712 CTAAATGCTGTTTGAAAAGCTGG - Intronic
1121252675 14:92511574-92511596 CAAAGCCCTGTTTGAAAACATGG - Intergenic
1122069027 14:99193871-99193893 TAGACTCCTGTTTGAAAAGCAGG + Intronic
1124401189 15:29349015-29349037 AAAAGTCCAGTTGGCAGAGCAGG + Intronic
1124705736 15:31962472-31962494 CACAGTCCTGAAAGAAGAGCAGG - Intergenic
1128926361 15:71659872-71659894 CAGAGTGCTGTCTGTAGAGCTGG - Intronic
1129777191 15:78244532-78244554 CAAATTCCTGTTTGGGGAGAAGG - Intronic
1131538076 15:93253929-93253951 CACAGTCCTTTTTGGAGAGTGGG + Intergenic
1132865290 16:2090164-2090186 CAAAGTCCGCTTTGAAGGGATGG - Exonic
1134387515 16:13787594-13787616 CAATGTTCTGTTTCATGAGCTGG + Intergenic
1137883438 16:52076824-52076846 AATAGTCCTGTTTTAAAAGCAGG + Intronic
1138170235 16:54842349-54842371 CAAAGTACTACTTGAAGACCAGG + Intergenic
1141914239 16:87083342-87083364 CAAGGTACTGTTTTAAGAACAGG - Intergenic
1150858421 17:68775446-68775468 CCAAGCCATATTTGAAGAGCTGG - Intergenic
1155375385 18:25151517-25151539 CAAAGTTCTGCTTAAAGAGTGGG - Intronic
1155952577 18:31929219-31929241 CAAACTCCTGTTTTCAGAGGTGG + Intronic
1157131692 18:45013335-45013357 CAAAGGCCTGTTTGTAGAGCTGG + Intronic
1158165152 18:54531859-54531881 CAAAGTCCTAATTGAACACCTGG - Intergenic
1160695700 19:483336-483358 CATGGTCATGTCTGAAGAGCTGG - Intergenic
1160856446 19:1220081-1220103 CAAAGTCTTGCTGGAACAGCAGG - Intronic
1161108102 19:2454689-2454711 CAGTGTCCTGTTGGGAGAGCTGG - Intronic
1161780794 19:6290617-6290639 CTAAGTCCTGATTGAGGAGAGGG + Intergenic
1162142990 19:8595854-8595876 CAAAGTCCTGTCTGGGGGGCCGG + Exonic
1162221234 19:9178489-9178511 GTAAGTCCTGTTTCAAGAGAGGG - Intergenic
1162320004 19:9966165-9966187 CCAAGTCCTGCCTCAAGAGCTGG - Intronic
1166353768 19:42215200-42215222 CTCTGTCCTCTTTGAAGAGCTGG + Exonic
1166654478 19:44600129-44600151 CAAAGTCATGTTTGAGGGGCTGG + Intergenic
1168048350 19:53810221-53810243 GAAAATCCTATTTGAGGAGCAGG - Exonic
924981277 2:223805-223827 TAGAGTCCTGTATGGAGAGCAGG - Intronic
925222123 2:2150475-2150497 CAAAGTACAGTTTGAACACCAGG + Intronic
925405378 2:3602616-3602638 CTAAGTCCCGTCTCAAGAGCAGG + Intronic
925497183 2:4465148-4465170 AAAAGGCTTGTTTGAAGAGCTGG + Intergenic
926063550 2:9820017-9820039 CCAAACCCTGTGTGAAGAGCAGG - Intergenic
926718786 2:15943323-15943345 CAAAGCCCTGTTTAAGGCGCAGG + Intronic
926908201 2:17825538-17825560 CAAAGTCCTCCCTGAAGAACAGG - Intergenic
928208700 2:29307011-29307033 TAAAGTCCTGTATGTAAAGCCGG + Intronic
928690104 2:33790456-33790478 CAAAGTCATGTCTGAAGTGAAGG - Intergenic
930158988 2:48133946-48133968 TAAATTCCTGTTTTAACAGCTGG - Intergenic
931299486 2:60963097-60963119 CAAAGACCAGATTGAAGAGAAGG - Intronic
932537960 2:72619651-72619673 CAAAGTCGAGATTGAAGAGGGGG + Intronic
932675843 2:73780164-73780186 CAAAGTCCTGTTTACAGATCAGG - Intergenic
932892215 2:75607071-75607093 CAGGCTCCTGTTTGCAGAGCTGG - Intergenic
933001783 2:76934068-76934090 CAGAGTCCTGCTTTGAGAGCTGG - Intronic
933840720 2:86283942-86283964 AAATGACCTGTGTGAAGAGCAGG + Intronic
936089106 2:109489479-109489501 CAAAGTCCACTTAGAAGAGCTGG + Intronic
936531041 2:113277408-113277430 AAATGTCCCGTTTGCAGAGCGGG + Intronic
938552047 2:132391435-132391457 AAAAGTCATGTTTGAAGACAAGG - Intergenic
942695079 2:178633038-178633060 CACAGTCCTGTTTGGAGTGAGGG + Exonic
945842332 2:214902787-214902809 CAAAGTCTGTTTTGAAGAGAGGG - Intergenic
1170669418 20:18416855-18416877 CAAAATCCTGTTTTAAGAATAGG - Intronic
1175268001 20:57714205-57714227 AAAAGTCCTGCTTGGGGAGCCGG + Intergenic
1176968815 21:15242425-15242447 GGAAGTCCTCTTTGAAGTGCAGG + Intergenic
1177474406 21:21600683-21600705 CAACGTGCTGTTAGCAGAGCAGG - Intergenic
1178089781 21:29150326-29150348 CCAGGTCAGGTTTGAAGAGCTGG + Intronic
1178661651 21:34511747-34511769 CAAGGTCCTGTGTGCAGGGCAGG - Intergenic
1179232084 21:39513384-39513406 CAAAGTCCAATTTGAATAGTAGG + Intronic
1181624724 22:24115534-24115556 CAACTTCCTGTTGTAAGAGCAGG + Intronic
1183864275 22:40691813-40691835 CAAAGCTCTATTTGATGAGCTGG - Intergenic
1183887287 22:40894963-40894985 CATAGTCCTGATAGAAGAACTGG - Intronic
1184492889 22:44820428-44820450 CAACGTCCTGTGTGATGGGCGGG - Intronic
1184942833 22:47781542-47781564 CAGAGGCCTGCTTGAAGAGTAGG + Intergenic
950132823 3:10559002-10559024 CAAATTAGTGTTTGAAGGGCAGG - Intronic
951128122 3:19008009-19008031 CAAAGTCCTCCTTGAAGACAAGG + Intergenic
952158479 3:30669494-30669516 TATAGTCCCGTTTGAAGAGGCGG + Intronic
952561228 3:34595853-34595875 CAAAGTGCTATTTGAAGAACAGG - Intergenic
953491420 3:43355156-43355178 CAATGTCCTGCTGGCAGAGCTGG + Intronic
953850391 3:46462174-46462196 CACAGTGCTGTTTGTACAGCAGG - Intronic
954397538 3:50300875-50300897 CAAAGTCCTGGCTGACCAGCAGG - Intronic
956518056 3:70072416-70072438 AAAAGTGTTGTTTGAAGAGTAGG - Intergenic
957239968 3:77646674-77646696 CAAAGTCTTCTTTGAATATCAGG + Exonic
958526747 3:95270247-95270269 CATGGTCCTGCTTGAAGACCTGG - Intergenic
958558481 3:95710364-95710386 TATAGTCCAGTTTGAAGAGGTGG + Intergenic
962116694 3:132517330-132517352 CATGGTCCAGTTTGGAGAGCAGG + Intronic
962267880 3:133956257-133956279 CAGAGTCCAGTGTGAGGAGCAGG - Intronic
964045858 3:152325697-152325719 CAAAGCCCTGTTTGTAAACCAGG + Intronic
964219888 3:154331127-154331149 CAAAGTCACATTAGAAGAGCAGG + Intergenic
967163201 3:186757697-186757719 CGAAATCCCGTTTGAAGAGGAGG + Intergenic
969269096 4:6086652-6086674 CACTGTCCTGGTTGAATAGCAGG + Intronic
970567962 4:17350921-17350943 CAGAGTCCTGAGTGACGAGCAGG + Intergenic
970893006 4:21068651-21068673 GAAAGTCCTCATTGAAGAGGAGG - Intronic
971508768 4:27397963-27397985 CAATGTCCTGTTTAAGGAGATGG + Intergenic
972341754 4:38158043-38158065 CAAGGTCCTGTCTGAAGAAAGGG - Intergenic
975126963 4:70793830-70793852 CAAAGTCCTGTTTGAAGAGCCGG - Exonic
978017208 4:103759326-103759348 AAAAGTCCTATTTGAATATCAGG + Intergenic
990197026 5:53329321-53329343 AAAAGTATTGTTTGAAGACCAGG + Intergenic
991596506 5:68312258-68312280 CAAAGGCCATTTGGAAGAGCAGG - Intergenic
992358321 5:76008921-76008943 GAAGGGCCTGTTTGAAGAACAGG - Intergenic
994947617 5:106416031-106416053 CAAAGTCCTGTTTGAAGAGCCGG + Intergenic
995137499 5:108695809-108695831 CAAAATCCTGTCTCAAGAGGAGG + Intergenic
995550741 5:113278551-113278573 CTAAGTCCTATATGATGAGCAGG + Intronic
995791761 5:115896481-115896503 CAAAATTATGTTTGAAGACCAGG + Intronic
996211861 5:120819897-120819919 TATAGTCCAGTTTGAAGAGGTGG + Intergenic
997038191 5:130218460-130218482 CAAAGTCCTGATTCTAGGGCTGG + Intergenic
997088099 5:130825087-130825109 CAAAGTCCCTTTTTAAGAGAAGG + Intergenic
998303745 5:141052463-141052485 CAAAGTCCTGGTAGAAGTGGTGG + Exonic
999376868 5:151092847-151092869 CAAACAGCTGTCTGAAGAGCTGG + Intronic
999945266 5:156588804-156588826 CAGAGTCCTTATAGAAGAGCAGG - Intronic
1001270077 5:170304443-170304465 CAAAGGACAGTTTTAAGAGCAGG - Intergenic
1001698033 5:173686945-173686967 AAAAGTCCTCTCTGAGGAGCTGG - Intergenic
1004895667 6:20145377-20145399 CAAAGTACTGTATGTAGAGTGGG - Intronic
1007179419 6:39917896-39917918 CAAAGGCATTCTTGAAGAGCTGG + Intronic
1007792310 6:44317662-44317684 CAAAGTTCTATTTCAAGACCTGG - Intronic
1008453525 6:51681314-51681336 CAATGTCTGGTCTGAAGAGCTGG - Intronic
1008545047 6:52576864-52576886 CGAACTCCTGGCTGAAGAGCGGG + Exonic
1011732093 6:90275309-90275331 TCAAGTCATATTTGAAGAGCAGG - Intronic
1012813550 6:103991804-103991826 AAAAATCCTGTATGAAAAGCTGG + Intergenic
1013294067 6:108743238-108743260 CAAAGTGCAGCTTCAAGAGCGGG - Intergenic
1014264998 6:119267621-119267643 CAAAGTCCTGTTTCTTGATCTGG - Intronic
1015949882 6:138541544-138541566 CAGAGTCCCCTTTGAAGAGAAGG + Intronic
1020213725 7:6173149-6173171 CAACTTCCTGCTTGCAGAGCAGG + Intronic
1021924796 7:25523909-25523931 AAAAGGCCTCTCTGAAGAGCTGG + Intergenic
1023265031 7:38395519-38395541 CAGAATCCTGTTTAAAGAGTTGG - Intronic
1024322626 7:48086082-48086104 CAAAGACCTTGTTGAGGAGCAGG + Intergenic
1024905125 7:54370210-54370232 CAAATTCATGTTTGAAAGGCGGG + Intergenic
1025846226 7:65200714-65200736 CAGAGACCTGTTTGAAGGGAAGG - Intergenic
1025896446 7:65706442-65706464 CAGAGACCTGTTTGAAGGGAAGG - Intergenic
1027678732 7:81191776-81191798 AAAAATCTTGTTTGGAGAGCTGG + Intronic
1027959326 7:84924114-84924136 CAAAGTCCTGTATGAAAGGGCGG - Intergenic
1028364826 7:90015828-90015850 CAAAGATCTGTTGGAAGAGTAGG - Intergenic
1035448382 7:158958258-158958280 CAAAGCCGTGGTTGAAAAGCAGG + Intergenic
1036163670 8:6411173-6411195 CACAGGCCTGGTTGAAGAGTTGG + Intronic
1037576685 8:20212119-20212141 CAAAGTCAGATTTGAAGAACCGG - Exonic
1039237761 8:35521376-35521398 CAAAGTCTTTGTTGAATAGCAGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1047011754 8:120680133-120680155 CAAAGTTCTGTTTTTAAAGCAGG - Intronic
1052851343 9:33380315-33380337 CAAAGTGCTGTAAGAAGAGCTGG + Intergenic
1053175945 9:35923999-35924021 CAAAGTCCGGTTTGATGACTTGG - Intergenic
1053222290 9:36322530-36322552 CAACTTCTAGTTTGAAGAGCAGG - Intergenic
1053729684 9:41040509-41040531 AAAAGTTCTGTGTGATGAGCTGG - Intergenic
1054698823 9:68391553-68391575 AAAAGTTCTGTGTGATGAGCTGG + Exonic
1055153973 9:73038429-73038451 CAAAGTCCAGTTTGGAGAAAAGG + Intronic
1058306389 9:103446689-103446711 AAAAATCCTGTTTGAAAAGGAGG - Intergenic
1060250447 9:121982739-121982761 ATAAGTCATGTTTGAATAGCTGG + Intronic
1062325335 9:136010048-136010070 TGAAGTCCTGTGTGAAGTGCTGG - Exonic
1203771663 EBV:52834-52856 CAAAGCCCTGATGGAAGACCTGG - Intergenic
1186559578 X:10596810-10596832 CAAAACCCTGTTAGAAGAGAAGG + Intronic
1186777017 X:12875134-12875156 CAAACTTTTGTTTGAAGAGTAGG + Intronic
1189550461 X:42087311-42087333 AGAAGTCCTGTTGGAAGAGTGGG - Intergenic
1192743886 X:73919571-73919593 CACAGTCCTGATTTAAGTGCTGG - Intergenic
1194144571 X:90246707-90246729 CAAAGTTCTGTTTTGAGAGTGGG - Intergenic
1196123518 X:112075724-112075746 CAAGGGCCTGTTTGATGAGGGGG - Intronic
1199972743 X:152872818-152872840 CACAGTCCTCTTTGAGAAGCTGG - Intergenic
1200490328 Y:3816012-3816034 CAAAGTTCTGTTTTGAGAGTGGG - Intergenic