ID: 975134217

View in Genome Browser
Species Human (GRCh38)
Location 4:70858431-70858453
Sequence ATGTTCACCTCTAAGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975134217_975134220 21 Left 975134217 4:70858431-70858453 CCTTAATTCTTAGAGGTGAACAT No data
Right 975134220 4:70858475-70858497 GAGGCTGAGTTCATCTCAAAGGG No data
975134217_975134218 2 Left 975134217 4:70858431-70858453 CCTTAATTCTTAGAGGTGAACAT No data
Right 975134218 4:70858456-70858478 TTTTCTTCTGATATGCAGTGAGG No data
975134217_975134219 20 Left 975134217 4:70858431-70858453 CCTTAATTCTTAGAGGTGAACAT No data
Right 975134219 4:70858474-70858496 TGAGGCTGAGTTCATCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975134217 Original CRISPR ATGTTCACCTCTAAGAATTA AGG (reversed) Intergenic
No off target data available for this crispr