ID: 975139190

View in Genome Browser
Species Human (GRCh38)
Location 4:70902653-70902675
Sequence ACGCCGGGCCCCGGGAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975139190_975139202 8 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139202 4:70902684-70902706 AGCGGGGCCCCGGGACTGCGCGG 0: 1
1: 0
2: 2
3: 23
4: 266
975139190_975139199 -1 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139199 4:70902675-70902697 TCACCACCAAGCGGGGCCCCGGG 0: 1
1: 0
2: 0
3: 17
4: 180
975139190_975139194 -9 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139194 4:70902667-70902689 GCCCGGCGTCACCACCAAGCGGG 0: 1
1: 0
2: 1
3: 8
4: 74
975139190_975139196 -8 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139196 4:70902668-70902690 CCCGGCGTCACCACCAAGCGGGG 0: 1
1: 0
2: 0
3: 13
4: 49
975139190_975139206 17 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139206 4:70902693-70902715 CCGGGACTGCGCGGAGCGCTCGG 0: 1
1: 0
2: 1
3: 17
4: 113
975139190_975139198 -2 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139198 4:70902674-70902696 GTCACCACCAAGCGGGGCCCCGG 0: 1
1: 0
2: 0
3: 38
4: 112
975139190_975139193 -10 Left 975139190 4:70902653-70902675 CCAGCGCTCCCGGGGCCCGGCGT 0: 1
1: 0
2: 1
3: 15
4: 211
Right 975139193 4:70902666-70902688 GGCCCGGCGTCACCACCAAGCGG 0: 1
1: 0
2: 1
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975139190 Original CRISPR ACGCCGGGCCCCGGGAGCGC TGG (reversed) Intronic