ID: 975139203

View in Genome Browser
Species Human (GRCh38)
Location 4:70902691-70902713
Sequence GAGCGCTCCGCGCAGTCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975139203_975139217 24 Left 975139203 4:70902691-70902713 CCCCGGGACTGCGCGGAGCGCTC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 975139217 4:70902738-70902760 ATAGGGCTTCGAGTACTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 9
975139203_975139208 6 Left 975139203 4:70902691-70902713 CCCCGGGACTGCGCGGAGCGCTC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 975139208 4:70902720-70902742 CCTAACCGCCGCCTCCCCATAGG 0: 1
1: 0
2: 0
3: 6
4: 62
975139203_975139209 7 Left 975139203 4:70902691-70902713 CCCCGGGACTGCGCGGAGCGCTC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 975139209 4:70902721-70902743 CTAACCGCCGCCTCCCCATAGGG 0: 1
1: 0
2: 0
3: 2
4: 31
975139203_975139216 23 Left 975139203 4:70902691-70902713 CCCCGGGACTGCGCGGAGCGCTC 0: 1
1: 0
2: 1
3: 7
4: 78
Right 975139216 4:70902737-70902759 CATAGGGCTTCGAGTACTCGTGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975139203 Original CRISPR GAGCGCTCCGCGCAGTCCCG GGG (reversed) Intronic
902691708 1:18113853-18113875 GAGCTCTTAGCTCAGTCCCGTGG + Intronic
903952908 1:27006405-27006427 CATCGCCACGCGCAGTCCCGAGG - Exonic
912576049 1:110674106-110674128 GAGAGCTCCGGGCCGGCCCGGGG - Exonic
921983714 1:221286002-221286024 AAGCGCGGCGCGCAGCCCCGGGG + Intergenic
1072970123 10:100009995-100010017 GCGCGGTCCGCGCGGCCCCGGGG + Intergenic
1073430383 10:103482440-103482462 GAGCGGTCCTGGCAGACCCGGGG + Intergenic
1077500873 11:2909318-2909340 GAGCGCTCCGGGCAGGCGCGAGG - Exonic
1078457988 11:11490580-11490602 GAGCACTCAGCCCAGTCCAGGGG + Intronic
1084086300 11:66856885-66856907 GGGCCCTCCGCGCTGTCCCCCGG - Intronic
1089453133 11:118610542-118610564 GGGCGCTCCCCGGAGCCCCGCGG - Intronic
1097990234 12:65825534-65825556 GAGTGCGCCGCGCGGCCCCGGGG + Intronic
1101970648 12:109309842-109309864 GGGCGCAGCGCGCAGTCCCGGGG - Intergenic
1102910375 12:116709021-116709043 GAGAGCTCCACGCAGGCACGGGG + Intergenic
1103400481 12:120640402-120640424 GAGCGCTGCCGGCACTCCCGGGG + Intergenic
1105472192 13:20704083-20704105 GGCCGGTCCGCGCAGCCCCGCGG - Exonic
1107830964 13:44373680-44373702 GAGCGCAGCGCGCAGAGCCGGGG - Intronic
1113311877 13:109140442-109140464 GCGCGCACTGCGGAGTCCCGGGG - Exonic
1119261032 14:73238042-73238064 GAACGCGCCGCGCACCCCCGAGG - Intronic
1119779954 14:77270927-77270949 GGGCGCTCCATGCTGTCCCGGGG + Exonic
1121546714 14:94768688-94768710 GCGCGCTTCCCCCAGTCCCGGGG + Intronic
1123187126 14:106530763-106530785 GAGCGCCCCCTGCAGTCCTGAGG + Intergenic
1124646536 15:31441065-31441087 GAGTGGTCCGCGCTGACCCGCGG + Intergenic
1124648092 15:31454087-31454109 GCGCGCCCCGAGCAGCCCCGTGG - Intergenic
1130317638 15:82809977-82809999 GTGCGCGCCGCGGAGCCCCGCGG - Exonic
1132722654 16:1324408-1324430 GAGCCCTCCTCGCAGCCCTGCGG + Intronic
1133136734 16:3717521-3717543 GAGCGCCGCGCGCAGCCACGCGG + Exonic
1133250316 16:4476490-4476512 GAGCTGTCCGCGCCCTCCCGGGG + Intronic
1142274899 16:89113269-89113291 GCGCGCTCCTCCCAGTCCCCAGG + Intronic
1142888786 17:2929704-2929726 GAGCGGGCAGGGCAGTCCCGGGG - Intronic
1151439089 17:74116622-74116644 GAGCGGCCCGCTCAGTCCAGGGG + Intergenic
1152167811 17:78722344-78722366 GAGCTCTGCGCCCAGTCCCTGGG - Intronic
1152345489 17:79748348-79748370 GAACGGTCAGCGCAGTCCCCCGG + Intergenic
1152432983 17:80260135-80260157 GAGCGCTCCGCGCGGGGCCGCGG + Intergenic
1159026034 18:63182976-63182998 GAGTGCTCCAGGCAGTACCGTGG - Intronic
1160863911 19:1249037-1249059 GAGCGCCGCCCGGAGTCCCGGGG - Intronic
1161099356 19:2413715-2413737 GAGGGCTCCTCGCAGACCAGGGG - Exonic
1161925065 19:7293923-7293945 GAGCGCGCGGCGCTGGCCCGCGG + Exonic
1162259243 19:9518964-9518986 GAGCGGTCCCCGCTGTCCCATGG + Intergenic
1165085618 19:33344463-33344485 GAGCGCTCAGCTCTGCCCCGTGG - Intergenic
1168240526 19:55086780-55086802 GACCGAGCCGCGCAGTCCCAGGG + Exonic
927544440 2:23940430-23940452 GCCGGCTCCGCGCAGACCCGAGG - Exonic
928143552 2:28751729-28751751 CAGCTCTCCGCGCAGGCGCGCGG - Intronic
929127703 2:38536158-38536180 GACCGCTCCGCGCACTCCCGGGG - Intergenic
929174227 2:38960526-38960548 GAGCGCGCCGCGCAGGCGCACGG + Exonic
929936519 2:46297760-46297782 GAGCGCCCCGCGCAGTCAGGTGG - Exonic
938500469 2:131829373-131829395 CGGCGCTCGGCGTAGTCCCGGGG + Intergenic
939657348 2:144844509-144844531 TAGTGCTCAGCACAGTCCCGTGG + Intergenic
947765240 2:232633618-232633640 GCGCGCTCCTCGCAGGCTCGAGG - Exonic
1171378257 20:24710478-24710500 GAGCGCTATGCCCAGTGCCGGGG - Intergenic
1175394868 20:58651091-58651113 GAGTGCTCCGCCCTCTCCCGGGG - Intergenic
1178485873 21:33020009-33020031 GCGCGCGCTGCGCAGCCCCGCGG + Intergenic
1184086776 22:42270345-42270367 GAGCCCCCCGCCCAGTCCCTCGG + Intronic
1184788272 22:46682517-46682539 GCGCCCTCGTCGCAGTCCCGAGG - Intergenic
954370267 3:50166460-50166482 GAGCACTCCGCACAGGCCCCAGG - Intronic
960691332 3:120349281-120349303 GAGCGCCGCGCGCGGTCCAGAGG + Exonic
961735869 3:129001867-129001889 GAGCGCTCTGCGCTGTGCTGGGG + Exonic
968701456 4:2059920-2059942 GGGAGCTCCGCGCCGGCCCGAGG - Intronic
969532764 4:7739001-7739023 GAGCGCTCCGTGAAGTACCTGGG - Intronic
975139203 4:70902691-70902713 GAGCGCTCCGCGCAGTCCCGGGG - Intronic
984811147 4:183797522-183797544 GGGCGCCCGGCGCAGTCCCTGGG - Intergenic
991054384 5:62306133-62306155 GCGCGCTCTGCGCAGGCGCGCGG + Intergenic
993901232 5:93585184-93585206 GGGCGCTCCGGGCTGGCCCGGGG - Exonic
997265171 5:132490990-132491012 GAGCGCTCGGGGCGGGCCCGCGG - Intergenic
999375103 5:151081110-151081132 GCGCGCTCCGGGCGGGCCCGCGG + Intronic
1002029398 5:176416648-176416670 CAGCGCTGCGCCCAGTCCTGAGG - Intergenic
1002896246 6:1382129-1382151 GCCCGCACCGCGCAATCCCGGGG + Intergenic
1007099249 6:39233347-39233369 GAGCGCTCCCTGCGCTCCCGGGG + Intergenic
1013273093 6:108560524-108560546 GAGCTGCCCGCGCAGTCCCCGGG + Intronic
1017880743 6:158560654-158560676 GAGCGCCCCGCGCTGCCCTGCGG + Intronic
1030138640 7:106284364-106284386 GAGCGCGCCGGGCTGGCCCGGGG + Intronic
1035431705 7:158828437-158828459 GCGCGCTCCGGGCAGGGCCGCGG + Intronic
1038327043 8:26579192-26579214 GAGGGCTCGGCGCAGTGCTGGGG + Intronic
1045482130 8:102600988-102601010 GAGCCCTCCACGCTGTCCCGTGG - Intergenic
1047494234 8:125398272-125398294 GACCGCTCCTCTCAGTCCAGGGG + Intergenic
1049066580 8:140321191-140321213 GAGCGCTCCAGGCAGTCTCATGG + Intronic
1049218465 8:141418175-141418197 GGGCGCTCTGGGGAGTCCCGGGG - Intronic
1049397796 8:142409637-142409659 GAGCGCTCAGGGCAGGGCCGAGG + Intergenic
1049787153 8:144456452-144456474 GAGGGCGCCGCACAGTCCAGGGG + Intronic
1053001122 9:34577866-34577888 GAGCGCGCCGAGCAGCCGCGGGG + Intronic
1055321673 9:75088495-75088517 GAGTGCTCCGCCCCGCCCCGCGG - Intergenic
1057401478 9:94726935-94726957 GACCGCTCCGCCCAGTCCCCAGG - Intronic
1057600098 9:96450285-96450307 GGGCGCTCTGGGGAGTCCCGTGG + Exonic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061320971 9:129829166-129829188 GAGCACTCCAGGCAGCCCCGAGG + Intronic
1061851322 9:133417793-133417815 GCGCGCCCCGAGCAGCCCCGTGG - Exonic
1061975867 9:134067834-134067856 GAGCGCCCCGCGCAGTCCGCCGG - Intronic
1062499228 9:136845195-136845217 CGGCGCTCGGCGTAGTCCCGGGG - Exonic