ID: 975140879

View in Genome Browser
Species Human (GRCh38)
Location 4:70917106-70917128
Sequence ATGCCCTTTTAGAACAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975140877_975140879 2 Left 975140877 4:70917081-70917103 CCTTGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975140879 Original CRISPR ATGCCCTTTTAGAACAGTGA AGG Intronic
No off target data available for this crispr