ID: 975143547

View in Genome Browser
Species Human (GRCh38)
Location 4:70941706-70941728
Sequence CTTTCTTTTCAGAGAAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975143541_975143547 22 Left 975143541 4:70941661-70941683 CCCTTACTCTGTTCCATCCTTCC 0: 1
1: 0
2: 9
3: 116
4: 1421
Right 975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG No data
975143543_975143547 9 Left 975143543 4:70941674-70941696 CCATCCTTCCTTGTGACATTTCT 0: 1
1: 0
2: 1
3: 68
4: 1139
Right 975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG No data
975143542_975143547 21 Left 975143542 4:70941662-70941684 CCTTACTCTGTTCCATCCTTCCT 0: 1
1: 0
2: 5
3: 222
4: 3067
Right 975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG No data
975143546_975143547 1 Left 975143546 4:70941682-70941704 CCTTGTGACATTTCTCTTTGGTA 0: 1
1: 0
2: 2
3: 22
4: 296
Right 975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG No data
975143540_975143547 30 Left 975143540 4:70941653-70941675 CCTTCTTTCCCTTACTCTGTTCC 0: 1
1: 1
2: 13
3: 135
4: 1495
Right 975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG No data
975143544_975143547 5 Left 975143544 4:70941678-70941700 CCTTCCTTGTGACATTTCTCTTT 0: 1
1: 0
2: 6
3: 64
4: 577
Right 975143547 4:70941706-70941728 CTTTCTTTTCAGAGAAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975143547 Original CRISPR CTTTCTTTTCAGAGAAACTT TGG Intronic
No off target data available for this crispr