ID: 975144345

View in Genome Browser
Species Human (GRCh38)
Location 4:70951251-70951273
Sequence ACTTTTCCACAGGGGTTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975144345_975144355 18 Left 975144345 4:70951251-70951273 CCCGCCAACCCCTGTGGAAAAGT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 975144355 4:70951292-70951314 TCCCTAGTGCCAAAAAGGTTGGG 0: 70
1: 1076
2: 1645
3: 1342
4: 956
975144345_975144354 17 Left 975144345 4:70951251-70951273 CCCGCCAACCCCTGTGGAAAAGT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 975144354 4:70951291-70951313 GTCCCTAGTGCCAAAAAGGTTGG 0: 62
1: 1057
2: 1735
3: 1388
4: 947
975144345_975144351 -5 Left 975144345 4:70951251-70951273 CCCGCCAACCCCTGTGGAAAAGT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 975144351 4:70951269-70951291 AAAGTTGTCTTCCGTGAAACTGG No data
975144345_975144353 13 Left 975144345 4:70951251-70951273 CCCGCCAACCCCTGTGGAAAAGT 0: 1
1: 0
2: 0
3: 17
4: 194
Right 975144353 4:70951287-70951309 ACTGGTCCCTAGTGCCAAAAAGG 0: 27
1: 473
2: 909
3: 1267
4: 1073

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975144345 Original CRISPR ACTTTTCCACAGGGGTTGGC GGG (reversed) Intronic
900370816 1:2331356-2331378 ACGTGGCCACAGGGGTGGGCGGG + Intronic
900956082 1:5887227-5887249 ACTCTACCAGAGGGGTTGGGCGG + Intronic
901644616 1:10709817-10709839 ACTTTTACACAGCAGTTAGCAGG + Intronic
903262193 1:22137330-22137352 AGATTTCCACAGGAGTTGCCAGG - Intronic
903462128 1:23527454-23527476 TCTTCTCCATAGGGGTTGGCAGG - Intronic
906057693 1:42929540-42929562 ACTTGACCAGAGGGCTTGGCTGG + Intronic
906164099 1:43672792-43672814 CCTTTTCAACTGGGGTAGGCAGG + Intronic
906825145 1:48971368-48971390 ATTTTTCCACTGGGGGTGGAGGG - Intronic
907639916 1:56178047-56178069 ACTTTTCCACAGAGGTTTAGTGG + Intergenic
910411934 1:86955456-86955478 ATTTTTCCACAGGGGGTGGGCGG - Intronic
911848289 1:102782902-102782924 ACAATTCCACAGGGCTTGGGAGG + Intergenic
912579275 1:110705559-110705581 ACAGTTCCACAGGGGTGGGGAGG + Intergenic
912901800 1:113659118-113659140 AGTTTTCCACAGCGGTCAGCCGG - Exonic
913693239 1:121299668-121299690 ACTTTACCACAGAGGCTGCCAGG - Intronic
914144317 1:144980412-144980434 ACTTTACCACAGAGGCTGCCAGG + Intronic
916480403 1:165209469-165209491 CCTTTTCCACAGAGGTTTGGGGG - Intronic
916716748 1:167452812-167452834 ACTTGTCCACTGGCGTTGGGGGG - Intronic
917538835 1:175894275-175894297 CCTTTCCCACAGGGGTGGCCAGG - Intergenic
919521816 1:198598764-198598786 ACCTGTCCACAAGGTTTGGCAGG + Intergenic
920107781 1:203566697-203566719 ACCATTCCCCAGGGATTGGCAGG - Intergenic
920480561 1:206318037-206318059 ACTTTACCACAGAGGCTGCCAGG - Intronic
920916395 1:210261463-210261485 AGTTTTCCCCAAGGGCTGGCTGG - Intergenic
921593678 1:217031878-217031900 ACATTTCCACAGGGCTTGGGGGG - Intronic
922098387 1:222461730-222461752 ACTGTTCCACAGGGCTAGGGAGG - Intergenic
1066619545 10:37330812-37330834 ACAGTTCCACAGGGCTTGGGGGG - Intronic
1068199722 10:53767102-53767124 ACTTTTCCACATAGGATGACTGG - Intergenic
1069690781 10:70350606-70350628 ACTTCTCAGCAGGGGCTGGCAGG - Intronic
1070209995 10:74307098-74307120 ACATTTCCACTGGGGTTTGGGGG - Intronic
1070457046 10:76627560-76627582 ACTATCCCACAGGAATTGGCGGG - Intergenic
1070737140 10:78870865-78870887 ACATTCCCACAGGGGTTGGTTGG - Intergenic
1071727911 10:88218374-88218396 CCTTTTCCACAATGGTGGGCGGG + Intergenic
1076516652 10:131049041-131049063 ACTTTTGAGCAGAGGTTGGCAGG - Intergenic
1077976688 11:7254098-7254120 ACTCTTTCTCAGGGGTTGCCTGG - Intronic
1080293690 11:30700798-30700820 ACATTTCCACAGGGCTGGGGAGG + Intergenic
1080844482 11:36014911-36014933 ACTTTTCCACATGGTTCGTCTGG - Intronic
1082686027 11:56240968-56240990 TCTCTTCCACAGGGATTGGATGG + Intergenic
1086577793 11:88360700-88360722 AATTTTCCACTGGGGAGGGCGGG - Intergenic
1086607194 11:88709877-88709899 ACTGTGCCACTGGAGTTGGCAGG + Intronic
1087156642 11:94910962-94910984 AGTTTTCCACAGGACTAGGCTGG + Intergenic
1089555368 11:119313010-119313032 GGTTGTCCACTGGGGTTGGCAGG + Intronic
1092315516 12:7409386-7409408 ATTTTTCCACGGGGGTCGGGGGG + Intronic
1093047880 12:14471577-14471599 ACAGTTCCACAGGGCTTGGGAGG + Intronic
1095357889 12:41297710-41297732 TGTTTTCCACTGGGGTTGGCTGG - Intronic
1095925083 12:47570304-47570326 CCTTTTCCACAGGGAGTGCCTGG - Intergenic
1098847925 12:75561125-75561147 ACTTTTCAAAAGGGGCTGGTGGG + Intergenic
1100226123 12:92557494-92557516 ACATGTCCACAGGATTTGGCAGG + Intergenic
1100688459 12:97012267-97012289 ACTTTTCCACAGGGTTGGAGTGG - Intergenic
1101147671 12:101856310-101856332 ACAGTTCCACAGGGCTTGGGAGG - Intergenic
1102666007 12:114573466-114573488 ACCTCTCCACAGGGTTTTGCAGG + Intergenic
1103210697 12:119164267-119164289 ACATTTCCACAGGGCCTTGCAGG - Intergenic
1104140736 12:125983964-125983986 ACTTTTGCTCAGGGCTGGGCAGG + Intergenic
1105285571 13:19000776-19000798 ACATTTCCACATGGCTTGGAAGG + Intergenic
1106051771 13:26197244-26197266 ACCTTTCCCCAGGTGTTGGCTGG - Intronic
1106436096 13:29724151-29724173 AGTTTTGGTCAGGGGTTGGCTGG + Intergenic
1107505977 13:41033739-41033761 ATTTTTCCACAGAAGTTGGTGGG - Intronic
1108792133 13:53983027-53983049 ACCTTTCCACAGGGATGGGAAGG + Intergenic
1109227332 13:59712860-59712882 ATTTTTCCACAGGGGTGAGGGGG + Intronic
1111087344 13:83393673-83393695 ACGATTCCACAGGGTTTGGGAGG + Intergenic
1113381484 13:109809967-109809989 GCTTCTCCACAGAGGATGGCAGG - Intergenic
1116216695 14:42025589-42025611 AGTTTTAAACAGGGGTTGGAGGG - Intergenic
1117001210 14:51373556-51373578 ACTCTTCCACAGGGCTGGGGAGG + Intergenic
1117295137 14:54372156-54372178 AGTTCTCCACAGTGGGTGGCCGG - Intergenic
1118070490 14:62241942-62241964 TATTTTCCACAAGTGTTGGCCGG - Intergenic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119018938 14:71089485-71089507 ACAGTTCCACAGGGGTGGGGAGG + Intronic
1119522897 14:75299088-75299110 ACTTTTCCACACGAGTTGAAGGG - Intergenic
1119878223 14:78078235-78078257 ACTTCTCCACAGAGTCTGGCTGG + Intergenic
1125567982 15:40692476-40692498 AATTTTCCACAGGGCTCGGGGGG - Intergenic
1128757640 15:70194332-70194354 CCTTTTGCAGAGGGGCTGGCAGG + Intergenic
1129494905 15:75970173-75970195 ACTTTTCAAAAGGAGTTGTCAGG - Intronic
1129864413 15:78893755-78893777 GCTTTGACACAGGAGTTGGCTGG + Intronic
1130923270 15:88366628-88366650 AAGCTTCCACAGGGGCTGGCTGG - Intergenic
1131392330 15:92059466-92059488 ACTTTTCCCCAGGGCTTCACAGG + Intronic
1134447189 16:14339535-14339557 ACTTTTCTACAGAAGTTAGCTGG - Intergenic
1134820510 16:17243296-17243318 ACTTTAACAAAGGGATTGGCAGG - Intronic
1136376028 16:29865421-29865443 CCTTTTCACCAGGAGTTGGCAGG - Intergenic
1139212719 16:65095743-65095765 ACCTTAGCACAGAGGTTGGCTGG - Intronic
1139631964 16:68236447-68236469 ACTCTTCCCCAGGGGTCGTCAGG + Exonic
1141888592 16:86910711-86910733 AATTCTCCTCAGGGTTTGGCCGG - Intergenic
1143650990 17:8264280-8264302 CCAGGTCCACAGGGGTTGGCAGG - Exonic
1147696927 17:42362299-42362321 TCTTTTCCTGAGGGGATGGCAGG - Intronic
1148891208 17:50808680-50808702 ACGGTCCCACAGGGGCTGGCCGG + Intergenic
1149360436 17:55889412-55889434 AATTTTCCACAGATGTGGGCAGG - Intergenic
1150524959 17:65912809-65912831 ATTTTTCTACAGGGCTTGCCAGG + Intronic
1151192297 17:72407412-72407434 TCTTTGCCACAGGTGTTGCCAGG + Intergenic
1156036719 18:32772563-32772585 AGTCTTTCAGAGGGGTTGGCGGG - Intronic
1158764870 18:60437616-60437638 ACATTTCCAGAGATGTTGGCAGG - Intergenic
1159037528 18:63292206-63292228 TTTTTTGCACTGGGGTTGGCTGG - Intronic
1159761418 18:72430955-72430977 ACAGTTCCACATGGCTTGGCAGG + Intergenic
1160330039 18:77983048-77983070 ACTTTTCCGCAGCTGTTGCCTGG + Intergenic
1165730357 19:38141172-38141194 TTTTCTCCCCAGGGGTTGGCCGG + Exonic
925668801 2:6290159-6290181 GCTTTTGCACAGGGATTAGCTGG + Intergenic
926336686 2:11868162-11868184 TCTTTCACACAGGGGTTGGTAGG + Intergenic
927288755 2:21383811-21383833 ACTCCTCCACATGGGTTGCCTGG - Intergenic
930966075 2:57328576-57328598 ACTTTTGCACAGAGGTTTTCTGG + Intergenic
931109965 2:59099647-59099669 ACTATTCCACATGGGTGGGGAGG + Intergenic
931446672 2:62332634-62332656 ACTTTTCCAAATGGGCTGCCAGG + Intergenic
932508727 2:72263607-72263629 TCTTTCCCAAAGGGGTTGGAAGG + Intronic
932959979 2:76402245-76402267 ATTTTTCCACAGGTGGTGGCAGG - Intergenic
933446386 2:82385128-82385150 ACAGTTCCACAGGGCTTGGGAGG - Intergenic
938695319 2:133829954-133829976 ACTTTTCCCCTGGGTTTGTCAGG - Intergenic
939356158 2:141105639-141105661 ACTTTTCCAAAGAGTTTGACAGG - Intronic
939830572 2:147065401-147065423 ACAGTTCCACAGGGCTTGGGAGG - Intergenic
940062312 2:149586347-149586369 AGTTTTTCAAAGGGGTAGGCGGG + Intronic
940082967 2:149825572-149825594 ACAGTTCCACAGGGCTGGGCAGG - Intergenic
941512899 2:166436430-166436452 ACGGTTCCACAGGGCTTGGGAGG - Intronic
942447922 2:176090824-176090846 ACTTTTAAAGAGGGTTTGGCTGG - Intergenic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
946885524 2:224218613-224218635 ACTTATACACAGTGGTTGGGAGG + Intergenic
948685744 2:239668578-239668600 GCTGGTCCAGAGGGGTTGGCTGG + Intergenic
948704177 2:239779011-239779033 ACCATGCCACAGGGGTTGGAGGG - Intronic
948830570 2:240596589-240596611 ACTTTCCCTCTGTGGTTGGCAGG + Intronic
1170263588 20:14440667-14440689 ACTTTTCCACAAGGTTGGCCTGG + Intronic
1174400948 20:50275586-50275608 ACTGTTTCACAAGGGTTGCCGGG - Intergenic
1174869125 20:54167271-54167293 TGTGTTCCACAGTGGTTGGCAGG + Intronic
1175096171 20:56543209-56543231 ACTGTTCCACAGGGCTGGGGAGG - Intergenic
1181811796 22:25407705-25407727 AATTTTCAACAGGGGTGGTCAGG - Intergenic
1184239136 22:43202692-43202714 ACATTTCCACATGGCTTGGGAGG - Exonic
1184761989 22:46550141-46550163 CCTTCTCCACACGGGTTGGGGGG - Intergenic
951952766 3:28219473-28219495 ACAGTTCCACAGGGCTTGGGAGG + Intergenic
953054847 3:39379911-39379933 AATTTCCCACAGGGGTAAGCAGG - Intergenic
953570111 3:44064603-44064625 AGTTTCCCACAGGGATGGGCAGG - Intergenic
953849347 3:46454405-46454427 ACTGTTCCACAGGGAGGGGCTGG - Intronic
957571250 3:81949745-81949767 TTTTTTTCATAGGGGTTGGCTGG + Intergenic
961141138 3:124557524-124557546 GTTTTTGCACAGGAGTTGGCAGG + Intronic
961443233 3:126965253-126965275 CCTTTACCACAGGGGGTGGCCGG - Intergenic
970475419 4:16417309-16417331 ACATTTCCACAGGGCTGGGGAGG + Intergenic
970499486 4:16662794-16662816 ACATTTCCACATGGCTTGGGAGG - Intronic
971009740 4:22420465-22420487 ACTTCTCCACTAGGCTTGGCAGG + Intronic
972683843 4:41332642-41332664 CTTTTTGCACAGGGGTTGGCGGG + Intergenic
973641843 4:52910933-52910955 ACAGTTCCACAGGGCTTGGGAGG - Intronic
974741465 4:66013418-66013440 AATTTTCCATAAGTGTTGGCCGG - Intergenic
975144345 4:70951251-70951273 ACTTTTCCACAGGGGTTGGCGGG - Intronic
979583815 4:122391307-122391329 ACATTCCAACAGGGGTTGTCAGG - Intronic
979651467 4:123136964-123136986 ATTTTTCCACAGGTGTGGGGCGG + Intronic
980179728 4:129389067-129389089 ACTTTTTCACATGGCTTGGGAGG - Intergenic
980180887 4:129399312-129399334 TATTTTCCATAAGGGTTGGCTGG + Intergenic
980400336 4:132276355-132276377 ACCTCTCAACAGGGGTTGACAGG + Intergenic
980480997 4:133386808-133386830 ACATTTCCACATGGGTGGGGAGG - Intergenic
982747355 4:159118491-159118513 CTTTTTCCACAGGGTTGGGCGGG - Intronic
983825017 4:172248870-172248892 ACAGTTCCACAGGGGTAGGGAGG - Intronic
984900936 4:184585845-184585867 AGTTTTCCACAGGGGGTGGAGGG - Intergenic
985442914 4:189997490-189997512 ACAGTTCCACATGGCTTGGCAGG + Intergenic
985630352 5:1010714-1010736 ACATTTGCACAGGGGCTTGCTGG + Intronic
988129247 5:27081070-27081092 ACATTTCCACATGGGTGGGAAGG + Intronic
988130746 5:27101542-27101564 ACTTTTCCACAGATGTTGTGGGG - Intronic
989300156 5:39881658-39881680 ACAGTTCCACAGGGCTTGGGAGG + Intergenic
991412955 5:66362946-66362968 TCTTTTCCACTGGGGCTGCCAGG + Intergenic
991563206 5:67976892-67976914 GCTTTCCCAGAGGGGGTGGCTGG + Intergenic
993711406 5:91229380-91229402 ACAGTTCCACAGGGCTTGGGAGG + Intergenic
994151877 5:96456990-96457012 ACAGTTCCACAGGGTTTGGAAGG - Intergenic
997088178 5:130826025-130826047 ACAGTTCCACAGGGCTTGGGAGG + Intergenic
997258266 5:132445824-132445846 AATTCCCCACAGGGGCTGGCAGG - Intronic
997504256 5:134404136-134404158 TCTTTTCCACAGGTGTTTGCAGG + Intronic
998510633 5:142711282-142711304 ACAGTTCCACAGGGGTGGGAAGG + Intergenic
998744067 5:145236830-145236852 ATTTTTCCAAAGAGGTTGTCAGG - Intergenic
999776742 5:154817991-154818013 ACTTTTCCACAGGGGGGTGAAGG + Intergenic
1001077622 5:168642381-168642403 AGTTTTCCACGGGTGTTGGAGGG + Intergenic
1001675411 5:173508527-173508549 AATTTTCCAAAGTGGTTGTCTGG + Intergenic
1003742036 6:8951773-8951795 TCTTTTCTAAAGGGGGTGGCGGG - Intergenic
1004500812 6:16208319-16208341 ACTTGTCCCCAGGGCTGGGCTGG - Intergenic
1006452852 6:34115086-34115108 ACCTCTCCTCAGGGGTTGCCTGG + Intronic
1010110054 6:72216576-72216598 TCTGTTACACAGGGCTTGGCAGG + Intronic
1010515034 6:76762226-76762248 ACATTTCCACAGGGATGGGGCGG + Intergenic
1010674208 6:78721787-78721809 ACAGTTCCACAGGGCTTGGGAGG - Intergenic
1011814528 6:91172990-91173012 TTTTTTCCACAGAGGGTGGCTGG + Intergenic
1013048057 6:106507453-106507475 ACTTTCCCACAGGCCTGGGCAGG - Intergenic
1017124947 6:151056691-151056713 AGCTTTCCAGAGGGGATGGCAGG - Intronic
1020912773 7:14153846-14153868 ACTTTTCCTCTGGGGTTTGAAGG - Intronic
1023495476 7:40790363-40790385 ACAGTTCCACAGGGCTTGGGAGG - Intronic
1025158862 7:56635708-56635730 ACTTTTCAACAGGGGTTTCCAGG + Intergenic
1027830353 7:83169243-83169265 ACAGTTCCACAGGGGTGGGGAGG - Intergenic
1028289172 7:89044292-89044314 ACTGTTCCACAGGGCTGGGAAGG - Intronic
1031045166 7:116879455-116879477 ATTTTTCCACAGGGGATAGCGGG + Intronic
1031049521 7:116930810-116930832 ACTTTTCTACAAGTGTTAGCCGG - Intergenic
1032011264 7:128349734-128349756 ACTTTGCTACAGGAGCTGGCTGG + Intergenic
1032074977 7:128831935-128831957 AGCTCTCCACAGGGGTGGGCGGG - Intronic
1033925179 7:146450391-146450413 TCTATTCCACAAGGGTGGGCAGG + Intronic
1034859384 7:154582854-154582876 ACTGTTCCCCAGGGGCTGGGTGG - Intronic
1034982704 7:155488925-155488947 ACGTTTCCAAAGGGTGTGGCTGG - Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1036632248 8:10524062-10524084 TCTTTTCAACAGGGGATGCCTGG - Intergenic
1037467553 8:19174766-19174788 ATGTTGCCACAGGGCTTGGCAGG + Intergenic
1038457518 8:27687053-27687075 ACTTTCCCCCAGGGGTGGGCAGG + Intergenic
1041166635 8:55098699-55098721 ATTTTTCCACTGGGGTTGTTGGG + Intergenic
1041654498 8:60335602-60335624 ACATTTCCACAGGGTTGGGGAGG - Intergenic
1042297416 8:67236546-67236568 CATTTGCCACATGGGTTGGCTGG + Intronic
1044228340 8:89744795-89744817 ACAGTTCCACAGGGCTTGGGAGG + Intergenic
1045422022 8:102025895-102025917 ACATTTCCACAGGGCTGGGGAGG + Intronic
1046167652 8:110458712-110458734 ACCTCTCCACAGGGTTTAGCAGG + Intergenic
1047079991 8:121449183-121449205 ACTGTTCCACAGGGCTAGGGAGG + Intergenic
1048395624 8:134011369-134011391 TCCTTTGCCCAGGGGTTGGCAGG + Intergenic
1049453588 8:142675807-142675829 ACTGATGCACATGGGTTGGCTGG - Intronic
1050218521 9:3358754-3358776 ACAGTTCCACAGGGCTTGGGAGG + Intronic
1050298900 9:4236437-4236459 CCTTTTCCACATGGGTTGGGAGG + Intronic
1052776962 9:32741953-32741975 ACTATTCCACTGCAGTTGGCAGG - Intergenic
1058469247 9:105260210-105260232 ACTTTTCAAATGGGGTTGGGAGG - Intronic
1059337929 9:113580815-113580837 ACTTTCCCCAAGGGGTGGGCGGG + Intronic
1060913494 9:127369667-127369689 ACTTTTTCACAGGGGTTGTGAGG + Intronic
1062390449 9:136331671-136331693 ACGTTTGCAGAGGAGTTGGCGGG + Intronic
1187779548 X:22803754-22803776 ACAGTTCCACAGGGCTTGGGAGG + Intergenic
1190644098 X:52508752-52508774 ACTTGTCCACAAGTGTTGGTGGG + Intergenic
1193084493 X:77437241-77437263 TGTTTTCCACAGGGTGTGGCTGG - Intergenic
1193839271 X:86388831-86388853 CATTTTCCACAGGTGTTGGTCGG + Intronic
1195428344 X:104761193-104761215 ACATTTCCACAGGGCTGGGGAGG + Intronic
1196651058 X:118168818-118168840 AATTTTCCACAGGGGATGTCTGG + Intergenic
1199227672 X:145396383-145396405 ACTTTTCAAAAGGAGATGGCAGG - Intergenic
1199532048 X:148860459-148860481 ACATTTTCACATGGGTTGCCAGG - Intronic
1199569496 X:149253313-149253335 ACATTTCCACATGGTTTGGGGGG + Intergenic
1199760393 X:150899822-150899844 ACTGTTCCTTAGGGGTTGGTGGG - Intergenic