ID: 975144417

View in Genome Browser
Species Human (GRCh38)
Location 4:70951994-70952016
Sequence GTTGTTAATGGGATTGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 757
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 701}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975144411_975144417 14 Left 975144411 4:70951957-70951979 CCTTTAAGACTTTCGTACGTTGT 0: 1
1: 0
2: 0
3: 1
4: 46
Right 975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG 0: 1
1: 0
2: 4
3: 51
4: 701
975144410_975144417 19 Left 975144410 4:70951952-70951974 CCTGTCCTTTAAGACTTTCGTAC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG 0: 1
1: 0
2: 4
3: 51
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975144417 Original CRISPR GTTGTTAATGGGATTGTAAA AGG Intronic
900303772 1:1992121-1992143 GTTGCTGGTGGGAGTGTAAAGGG + Intronic
900304460 1:1997644-1997666 GTTTTTGATGTGATTATAAACGG - Intronic
900531781 1:3157406-3157428 TTTTTTAATGGGATCGCAAAAGG - Intronic
900840919 1:5047788-5047810 GGTGTTAATGAGATGGTAAGGGG - Intergenic
900847606 1:5116063-5116085 GGTGTTAATGAGATGGTAAGGGG - Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902051047 1:13563812-13563834 GGTTTTAATGGGATGGTAAGGGG - Intergenic
903463747 1:23537653-23537675 ATTGCTGGTGGGATTGTAAATGG + Intergenic
903920940 1:26800244-26800266 ACTGTTAATAGGATGGTAAAAGG - Intergenic
904394081 1:30206325-30206347 GGTTTTAATGGGATGGTAAGCGG - Intergenic
904711753 1:32435279-32435301 GGTTTTAATGGGATGGTAAGGGG - Intergenic
905060399 1:35135102-35135124 GGTTTTAATGGGATGGTAAGGGG + Intergenic
905429407 1:37910587-37910609 GGTTTTAATGGGATGGTAAGGGG - Intronic
905499905 1:38428009-38428031 GGTTTTAATGGGATGGTAATGGG - Intergenic
906002250 1:42436857-42436879 ATTGCCAATGGGAATGTAAAAGG + Intronic
906081034 1:43088443-43088465 GGTTTTAATGGGATGGTTAAGGG - Intergenic
906378824 1:45318489-45318511 GGTTTTAATGGGATAGTAAGGGG - Intergenic
906744395 1:48211752-48211774 GGTTTTAATGGGATGGTAAGGGG + Intergenic
907177966 1:52543327-52543349 CTTTTTGATGGTATTGTAAATGG - Intronic
907583912 1:55598210-55598232 ATTGGTAGTGGGAATGTAAAAGG - Intergenic
908972342 1:69851926-69851948 GTTGTTTATGGGATAGTGACTGG + Intronic
909000311 1:70209987-70210009 GTTGTTACTGGAGTTGTATATGG + Intronic
909014837 1:70370330-70370352 GGTTTTAATGGGATGGTAAGGGG - Intronic
909035591 1:70591236-70591258 GGTTTTAATGGGATGGTAATGGG - Intergenic
909381241 1:75001214-75001236 ATTGCTAATGGAAATGTAAATGG - Intergenic
909603678 1:77487195-77487217 CTAGGTAATGGGATTGTATAAGG - Intronic
909793526 1:79703339-79703361 CTTTTTGATGTGATTGTAAATGG + Intergenic
909897837 1:81095531-81095553 GCTGTTAATGGTTTTGAAAAAGG + Intergenic
909910090 1:81248379-81248401 GGTTTTAATGGGATGGTAATGGG - Intergenic
910002613 1:82357627-82357649 GGTTTTAATGGGATGGTAAGGGG + Intergenic
910049515 1:82958281-82958303 GGTTTTAATGGGATGGTAAGGGG - Intergenic
910103357 1:83602449-83602471 GTTGTTGTTGCTATTGTAAATGG - Intergenic
910467719 1:87517919-87517941 GTTGATAAAGAGGTTGTAAATGG + Intergenic
910525604 1:88174157-88174179 GTTGTTAATGAGATAGAGAAGGG + Intergenic
910959156 1:92742789-92742811 ATTGTTAATGGAAATATAAATGG + Intronic
910980263 1:92953300-92953322 ATTGTTGGTGGGAATGTAAAAGG + Intronic
911071190 1:93832992-93833014 GGTTTTAATGGGATGGTAAGGGG - Intronic
911147862 1:94569634-94569656 GGTTTTAATGGGATGGTAAGGGG + Intergenic
911155495 1:94632817-94632839 CTTTTTGATGGTATTGTAAATGG + Intergenic
911155786 1:94635526-94635548 CTTTTTGATGGTATTGTAAATGG + Intergenic
912296598 1:108475877-108475899 GGTTTTAATGGGATGGTAAAGGG - Intergenic
912578605 1:110699626-110699648 ATAGTTGGTGGGATTGTAAATGG + Intergenic
912813687 1:112812380-112812402 GGTTTTAATGGGATGGTAAGGGG - Intergenic
913095656 1:115513344-115513366 GGTTTTAATGGGATAGTAAGAGG + Intergenic
913416295 1:118612278-118612300 ATTGTTGGTGGGAATGTAAATGG - Intergenic
913578506 1:120201735-120201757 ATTGCTAGTGGGAATGTAAAAGG - Intergenic
913629666 1:120696616-120696638 ATTGCTAGTGGGAATGTAAAAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914560432 1:148813175-148813197 ATTGCTAGTGGGAATGTAAAAGG - Intronic
914612401 1:149317040-149317062 ATTGCTAGTGGGAATGTAAAAGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914782061 1:150794319-150794341 GTTGTTAGTGGGAATGTAAAAGG - Intergenic
915787391 1:158629889-158629911 ATTTTTGATGTGATTGTAAAAGG - Intronic
916328979 1:163593953-163593975 GGTTTTAATGGGATGGTAAGGGG - Intergenic
917131266 1:171744270-171744292 GTTTTTGATGGGATAGCAAAGGG + Intergenic
917597974 1:176548815-176548837 GTTGTAAATGGGGATGAAAATGG + Intronic
917749787 1:178042918-178042940 GGTTTTAATGGGATGGTAAGAGG - Intergenic
917820384 1:178757054-178757076 GTTGTTGATTCTATTGTAAATGG + Intronic
918869976 1:189958076-189958098 GTCTTTAATTGGATTGTAATTGG + Intergenic
919029205 1:192217890-192217912 ATTTTTAATGCAATTGTAAATGG + Intergenic
919142487 1:193589831-193589853 GTTGCTAAAGGGATTTAAAAGGG + Intergenic
919476527 1:198037721-198037743 GGTTTTAATGGGATGGTAATGGG - Intergenic
919810066 1:201403459-201403481 GTTGTTGATGGGAGTGTAAGTGG + Intergenic
920425528 1:205872159-205872181 GGTTTTAATGGGATGGTAACGGG - Intergenic
920805347 1:209228590-209228612 GTTGATAATGGGATGGTTAAAGG + Intergenic
920829526 1:209451857-209451879 GGTTTTAATGGGATGGTAATGGG - Intergenic
920908130 1:210190230-210190252 GGTTTTAATGGGATAGTAATGGG - Intergenic
921271970 1:213478464-213478486 TTTGTTCATGGGAATGCAAATGG - Intergenic
921369905 1:214411186-214411208 TTTTTTAATGCTATTGTAAATGG + Intronic
921379407 1:214508639-214508661 GTTGTTAATGGCACTGAGAATGG + Intronic
922363416 1:224843229-224843251 GGTTTTAATGGGATGGTAAGTGG + Intergenic
922604343 1:226880022-226880044 CTTGTTAAGGGGATTGAAATTGG + Intronic
922845294 1:228679751-228679773 GGTTTTAATGGGATGGTAAGGGG + Intergenic
922934942 1:229415311-229415333 GGTTTTAATGGGATGGTAATGGG - Intergenic
923177540 1:231481709-231481731 ACTGTTGATGGGAATGTAAATGG - Intergenic
923649354 1:235859000-235859022 GTTACTATTGAGATTGTAAAAGG - Intronic
923962905 1:239104302-239104324 GGTTTTAATGGGATGGTAAGGGG - Intergenic
923970279 1:239194242-239194264 GTTGTTGATGATATGGTAAATGG + Intergenic
1064608459 10:17070612-17070634 TTTTTTAATGCTATTGTAAATGG + Intronic
1065337375 10:24667113-24667135 ATTGTTAGTGAGATTGTAATTGG - Intronic
1065405219 10:25356551-25356573 GCTGTTCATGTGATAGTAAATGG + Intronic
1065437751 10:25719387-25719409 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1066103274 10:32136435-32136457 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1066437090 10:35405288-35405310 GGTTTTAATGGGATGGTAAAGGG + Intronic
1067124220 10:43501854-43501876 TTTTTTAATGCTATTGTAAATGG - Intergenic
1067360528 10:45574141-45574163 GGTTTTAATGGGATGGTAAGAGG - Intronic
1068360895 10:55974136-55974158 GGTTTTAATGGGATAGTAATGGG - Intergenic
1068592216 10:58863789-58863811 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1069028383 10:63569084-63569106 GTTGTCTATGGAATTGTACAAGG - Intronic
1069557388 10:69407101-69407123 GTAGATGATGGGATTGTACATGG + Exonic
1069758344 10:70788199-70788221 GTTTTTAAAGGAACTGTAAATGG + Intergenic
1070014580 10:72513153-72513175 ATTGCTTATGGGAATGTAAATGG - Intronic
1070065612 10:73030908-73030930 ATTGCTAATGGGAATGTAAAAGG + Intronic
1070852604 10:79579476-79579498 ATTTTTAAAGTGATTGTAAATGG - Intergenic
1071022499 10:81074440-81074462 GTTTTTGATGCTATTGTAAATGG + Intergenic
1071187356 10:83060084-83060106 GGTTTTAATGGGATAGTAATGGG - Intergenic
1071364297 10:84883184-84883206 GTTGTAATTGGGATTTCAAAAGG + Intergenic
1071389452 10:85156762-85156784 TTTATCAATTGGATTGTAAAGGG + Intergenic
1071684306 10:87738316-87738338 ACTGTTAGTGGGATTGTAAAAGG - Intronic
1071821858 10:89287631-89287653 GGTTTTAATGGGATGGTAAGGGG - Intronic
1072020935 10:91400525-91400547 TTTTTGAATGGTATTGTAAATGG - Intergenic
1072884641 10:99262525-99262547 GGTTTTAATGGGATAGTAAGGGG - Intergenic
1073014140 10:100384673-100384695 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1073130831 10:101188148-101188170 GGTTTTAATGGGATAGTAATGGG + Intergenic
1073165447 10:101445108-101445130 GTTATTAATGGCATTGAAGATGG + Intronic
1073709366 10:106020387-106020409 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1073711842 10:106052290-106052312 ACTGTTAGTGGGATTGTAAAAGG - Intergenic
1074740902 10:116483587-116483609 GGTTTTAATGGGATGGTAATGGG - Intergenic
1075004875 10:118822902-118822924 GTTGTTAAAGGGTTTGCACAAGG + Intergenic
1075013619 10:118894884-118894906 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1075900062 10:126035421-126035443 ATTTTTAATGCCATTGTAAATGG + Intronic
1076219435 10:128721359-128721381 TTTTTTAATGGGTTTGTATACGG + Intergenic
1076352723 10:129829284-129829306 GTTTTTAATGCTATTGTAAATGG + Intergenic
1077612312 11:3650876-3650898 GGTTTTAATGGGATGGTAAGGGG - Intronic
1077766262 11:5163056-5163078 GGTTTTAATGGGATGGTAAGGGG + Intronic
1077861318 11:6183344-6183366 ATTGTTAGTAGGAATGTAAATGG + Intergenic
1078747641 11:14130348-14130370 GTGGTAAATGGCATTGGAAAAGG + Intronic
1078747685 11:14131068-14131090 GTGGTAAATGGCATTGGAAAAGG - Intronic
1078888612 11:15532133-15532155 ATTTTTGATGGTATTGTAAATGG - Intergenic
1079700956 11:23546829-23546851 GTTTTTTAAGTGATTGTAAATGG + Intergenic
1079726963 11:23889962-23889984 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1079847565 11:25489994-25490016 GTTTTTAATGAGATGGTAAGGGG + Intergenic
1079967697 11:26998799-26998821 GTTGTAAATGAGAGTTTAAAAGG - Intergenic
1081246626 11:40774774-40774796 AGTGATAATGGGAATGTAAAGGG + Intronic
1081356937 11:42123516-42123538 GGTTTTAATGGGATGGTAATGGG - Intergenic
1082197646 11:49324209-49324231 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1084354320 11:68627077-68627099 GGTTTTAATGGGATGGTAATGGG - Intergenic
1084613160 11:70217089-70217111 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1085934390 11:81124726-81124748 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1086133268 11:83422041-83422063 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1086134714 11:83434380-83434402 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1086550336 11:88046122-88046144 GGTTTTAATGAGATGGTAAAGGG - Intergenic
1086658179 11:89383918-89383940 GGTTTTAATGGGATGGTAAGGGG - Intronic
1087099211 11:94348655-94348677 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1088162665 11:106892144-106892166 GTAGTTGATGCTATTGTAAATGG + Intronic
1088185351 11:107160903-107160925 GTTTTTGATGCTATTGTAAATGG - Intergenic
1088549546 11:110997983-110998005 GTTGCTACTGGGAATTTAAATGG + Intergenic
1088555076 11:111053124-111053146 GGTTTTAATGGGATAGTAATGGG - Intergenic
1089087475 11:115834941-115834963 ATTGCTGATGGGAATGTAAAAGG + Intergenic
1089866931 11:121640700-121640722 GGTTTTAATGGGATGGTAATGGG + Intergenic
1089953432 11:122549886-122549908 GGTTTTAATGGGATGGTAATGGG - Intergenic
1090546374 11:127771849-127771871 GATTTTAATGAGATGGTAAAGGG + Intergenic
1091083764 11:132699106-132699128 TTTTTTAATGCTATTGTAAATGG + Intronic
1092319670 12:7459013-7459035 TTTGTTTATGGCATTGTGAATGG - Intronic
1092592636 12:9965844-9965866 GGTTTTAATGGGATGGTAAGGGG + Intronic
1093024459 12:14233511-14233533 GGTTTTAATGGGATGGTAAAGGG - Intergenic
1093136293 12:15455597-15455619 CTTTTTAATGTTATTGTAAATGG + Intronic
1093321863 12:17723047-17723069 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1093358554 12:18197889-18197911 GGTTTTAATGGGATGGTAATGGG - Intronic
1093578942 12:20766306-20766328 GGTTTTAATGGGATGGTAACAGG - Intergenic
1093812714 12:23508790-23508812 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1093915011 12:24791961-24791983 TTTATTAATGGGATTATGAAAGG - Intergenic
1093951193 12:25166083-25166105 GGTTTTAATGGGATGGTAAGGGG - Intronic
1094315932 12:29137777-29137799 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1095486555 12:42690657-42690679 GTTGCTAATAGGATTGGAAAAGG - Intergenic
1095989087 12:48021892-48021914 GTTGTTAATGTGTTTGTTTAGGG - Intronic
1096907074 12:54945710-54945732 GGTTTTAATGGGATAGTAATGGG + Intergenic
1097206861 12:57329916-57329938 GTTTTTGATGCTATTGTAAATGG + Intronic
1097371768 12:58791283-58791305 GTTGTTAATGCTATTGTAAATGG - Intronic
1098033174 12:66275329-66275351 GTTGCTGATGGGGTTGCAAAAGG - Intergenic
1098653709 12:73004790-73004812 GGTTTTAATGAGATTGTAAGGGG + Intergenic
1098660708 12:73089583-73089605 GTTTTTGATGCTATTGTAAATGG - Intergenic
1098775617 12:74610633-74610655 GTTGTTTATGGGAGTCCAAATGG - Intergenic
1099206900 12:79739197-79739219 GTTGTTAACTGGTCTGTAAAAGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099835975 12:87910167-87910189 GGTTTTAATGGGATAGTAAGGGG + Intergenic
1099872920 12:88370615-88370637 GGTTTTAATGGGATGGTAATGGG - Intergenic
1100374348 12:93999332-93999354 GTTGTTAGTTGGAATGTAAAGGG + Intergenic
1101635594 12:106538315-106538337 ATTGCTGATGGGAGTGTAAAAGG + Intronic
1102116621 12:110408042-110408064 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1102326040 12:111985426-111985448 GTGTTTAATGATATTGTAAATGG - Intronic
1102371416 12:112384950-112384972 GTTGTTATTAGGTTTGGAAAAGG - Intergenic
1102604608 12:114058778-114058800 GGTTTTAATGGGATAGTAATGGG - Intergenic
1102653511 12:114460861-114460883 GTTGTTATGGGGATTGAACAAGG + Intergenic
1103115112 12:118321911-118321933 GTTGTTAATGCAATTGTTAATGG - Intronic
1104650010 12:130524676-130524698 GGTGTTAAGGGGATTGAAGAAGG + Intronic
1106031098 13:26004261-26004283 GTTGTTGTTGTGCTTGTAAATGG + Intronic
1107346646 13:39468699-39468721 GTTGTTAATGAGAATGTAAAAGG - Intronic
1107802671 13:44124240-44124262 GTTGTTGTTGCTATTGTAAATGG + Intergenic
1107951101 13:45463049-45463071 GTTGTTAATGTGAATGTTATTGG + Intergenic
1108200199 13:48035619-48035641 GTTTTTTATGGTATTATAAATGG + Intergenic
1108281936 13:48869901-48869923 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1108606893 13:52048443-52048465 GTTGTTGTTGGTATTTTAAATGG - Intronic
1109324282 13:60848894-60848916 GTTCTTAATGGGTTTGAAATTGG + Intergenic
1109499416 13:63216051-63216073 GGTTTTAATGGGATGGTAATGGG - Intergenic
1109709537 13:66144106-66144128 GTTTTTAATGAGATGGTAAGGGG + Intergenic
1110430847 13:75421322-75421344 GGAGTTAGGGGGATTGTAAATGG - Intronic
1110734315 13:78917732-78917754 TTTTTTGATGGTATTGTAAATGG + Intergenic
1110845461 13:80186608-80186630 GTTTTTAATGGGATGGTAATGGG - Intergenic
1110978606 13:81869117-81869139 GGTTTTAATGGGATGGTAATGGG - Intergenic
1111506695 13:89199181-89199203 CCTGTTAAAGTGATTGTAAACGG - Intergenic
1112061522 13:95744222-95744244 ATTTTTACTGTGATTGTAAATGG + Intronic
1112225607 13:97536709-97536731 GTTGTCAATGGTCATGTAAATGG + Intergenic
1112889208 13:104210881-104210903 GGTTTTAATGAGATTGTAAGGGG + Intergenic
1112908263 13:104450442-104450464 TTTGTTTATGCTATTGTAAATGG - Intergenic
1113141182 13:107151528-107151550 GTTTTTGATGCTATTGTAAATGG + Intergenic
1114770932 14:25428471-25428493 GGTTTTAATGGGATGATAAAGGG + Intergenic
1115119638 14:29925571-29925593 TTTGGTAGTGGGATTTTAAATGG - Intronic
1115196780 14:30809372-30809394 ATTGAAAATGGGAATGTAAATGG + Intergenic
1115264733 14:31489326-31489348 GTTTTAAAAGGGATTTTAAAAGG + Intergenic
1115468507 14:33743117-33743139 GTTCTTAATGGCATTTTGAATGG + Intronic
1116202710 14:41819359-41819381 GATGTTAATATGAATGTAAAGGG - Intronic
1117174280 14:53131330-53131352 GATTTTAATGGGATAGTAATGGG - Intronic
1117677643 14:58170868-58170890 ATTGTTAGTGGGAAGGTAAATGG + Intronic
1118134845 14:63011916-63011938 GTTGGATAAGGGATTGTAAATGG + Intronic
1118396692 14:65343622-65343644 GTTGCTGAGGGGATGGTAAATGG - Intergenic
1118900141 14:69979544-69979566 GTGTTTACTGGGATTGGAAAAGG + Intronic
1118937132 14:70298573-70298595 GGTTTTAATGGGATGGTAATGGG + Intergenic
1119560147 14:75583449-75583471 GATTTTAATGGGATAGTAATGGG + Intronic
1120539437 14:85735746-85735768 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1120659833 14:87237812-87237834 GGTTTTAATGGGATGGTAATGGG + Intergenic
1120897738 14:89549419-89549441 GTTGTAATTGGGATTGTTGAAGG - Intronic
1121067030 14:90977480-90977502 GGTGGAAATGGGAGTGTAAAGGG + Intronic
1121193161 14:92047484-92047506 GGTTTTAATGGGATAGTAATGGG + Exonic
1121691342 14:95879165-95879187 GTCGTTAATGGGGTTGTCATTGG + Intergenic
1121980461 14:98449896-98449918 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1122259702 14:100507673-100507695 GTTGCAAATGGTATTGCAAATGG + Intronic
1122507753 14:102242548-102242570 GGTTTTAATGGGATAGTAAGGGG - Intronic
1122513094 14:102285917-102285939 GTAGTGAATGGGAATGTACAGGG - Intronic
1123715447 15:23026531-23026553 GTTGTTAATTTCAGTGTAAATGG - Intronic
1123968178 15:25479811-25479833 TTTGATAATGGGCATGTAAACGG + Intergenic
1124160734 15:27266776-27266798 ATTTTTGATGGTATTGTAAATGG + Intronic
1124508537 15:30301741-30301763 GTTTTTGATGCTATTGTAAATGG + Intergenic
1125853758 15:42929416-42929438 ATTGTTGGTGGGAATGTAAATGG + Intergenic
1125858302 15:42972945-42972967 GTTGTTGATGGGGATGCAAAAGG - Intronic
1125897737 15:43316669-43316691 GTTATTTATGGGATCATAAACGG - Intergenic
1127955879 15:63852770-63852792 GTTTTTAATGCTCTTGTAAATGG - Intergenic
1129222778 15:74142396-74142418 GTTGCCATTGGGAATGTAAATGG + Intergenic
1129259557 15:74356865-74356887 GGTTTTAATGGGATGGTAAGGGG - Intronic
1129799421 15:78402513-78402535 CTTGTTGGTGGGAGTGTAAACGG + Intergenic
1130304674 15:82705184-82705206 GGTTTTAATGGGATGGTAAGGGG - Intronic
1130383616 15:83392783-83392805 GTTGTCTATGGGAGTGTGAAGGG + Intergenic
1130729002 15:86470775-86470797 TTTTTTAATGCTATTGTAAATGG + Intronic
1130781184 15:87042586-87042608 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1130807572 15:87342339-87342361 GTTGGGAATGCTATTGTAAATGG - Intergenic
1131164994 15:90135767-90135789 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1131277007 15:90990586-90990608 ACTGCTAATGGGATTTTAAAGGG + Intronic
1131317472 15:91352659-91352681 ATTAATTATGGGATTGTAAATGG - Intergenic
1131386779 15:92014644-92014666 GTTGTTAATTTGATTTTTAAAGG - Intronic
1131630414 15:94170444-94170466 CTTTTTGATGGTATTGTAAAAGG - Intergenic
1131684302 15:94753710-94753732 GGTTTTAATGGGATGTTAAAGGG - Intergenic
1131740034 15:95379302-95379324 GTATATAATGGGATTGTAATGGG - Intergenic
1133158284 16:3891133-3891155 GTTGCTAGTGGGAATGTAAATGG - Intergenic
1133651518 16:7817635-7817657 GGTTTTAATGGGATGGTAACGGG - Intergenic
1133766635 16:8842864-8842886 GGTTTTAATGGGATGGTAATGGG + Intronic
1133869427 16:9673863-9673885 GGTTTTAATGGGATGGTAAGGGG + Intronic
1135025287 16:18994908-18994930 GGTTTTAATGGGATGGTAAGGGG + Intronic
1135504803 16:23027253-23027275 GGTGTTAGTGGGATTGAAGAGGG + Intergenic
1135516054 16:23135575-23135597 CTTGTTGATGCTATTGTAAATGG - Intronic
1135896314 16:26407539-26407561 ATTGCTGATGGGAATGTAAATGG + Intergenic
1137055229 16:35742705-35742727 GGTTTTAATGGGATAGTAATGGG + Intergenic
1137363547 16:47841466-47841488 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1138479849 16:57295038-57295060 ATTGCCAATGGGAATGTAAATGG - Intergenic
1138612101 16:58133505-58133527 ATTGCTAATGTGAGTGTAAATGG - Intergenic
1138753247 16:59449880-59449902 CTTCTTGATGGTATTGTAAATGG + Intergenic
1138758975 16:59520410-59520432 GGTTTTAATGAGATTGTAAGGGG + Intergenic
1138805078 16:60081769-60081791 GGTTTTAATGAGATTGTAAGGGG - Intergenic
1139009800 16:62617570-62617592 GTTGTTGTTGCTATTGTAAATGG - Intergenic
1140129184 16:72144080-72144102 GTTGTTATTGGTTTTATAAATGG - Intronic
1140171074 16:72605669-72605691 CTTTTTGATGGTATTGTAAATGG - Intergenic
1140891220 16:79286971-79286993 GTTTTTAATGGGTTTCCAAAGGG - Intergenic
1143074196 17:4326475-4326497 ATTGCTAATGGGAATGTAAGAGG + Intronic
1143414234 17:6734417-6734439 GGTTTTAATGGGATGGTAAGAGG + Intergenic
1146598027 17:34186216-34186238 GGTTTTAATGGGATGGTAATGGG - Intergenic
1146860731 17:36295994-36296016 ATTGATAGTGGGAATGTAAATGG - Intronic
1147091059 17:38100089-38100111 ATTGATAGTGGGAATGTAAATGG - Intergenic
1147106152 17:38220415-38220437 ATTGATAGTGGGAATGTAAATGG + Intergenic
1148423355 17:47568101-47568123 ATTGCTAATGGGAATGTAAATGG - Intronic
1149220626 17:54412395-54412417 GGTTTTAATGGGATAGTAATGGG - Intergenic
1149423740 17:56534917-56534939 GTTGTGGGTGGGATTGAAAAAGG + Intergenic
1149976280 17:61269531-61269553 ATTGTTGGTGGGAATGTAAATGG - Intronic
1150022101 17:61627802-61627824 ATTGTTGGTGGGAATGTAAACGG - Intergenic
1152454086 17:80402838-80402860 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1153881600 18:9426053-9426075 GGTTTTAATGGGATAGTAATGGG + Intergenic
1154003089 18:10501835-10501857 CTTTTTAATGCTATTGTAAATGG + Intergenic
1154078385 18:11228619-11228641 TTTGTTAATGCTAATGTAAATGG - Intergenic
1154948951 18:21189397-21189419 ATTTTTTATGTGATTGTAAATGG + Intergenic
1155098775 18:22587615-22587637 GTTGTTTATGAGATAGTTAAAGG - Intergenic
1155941668 18:31806738-31806760 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1155962123 18:32003544-32003566 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1156237482 18:35218706-35218728 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1156251809 18:35359088-35359110 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1156302372 18:35846862-35846884 AATTTTAATGGGATGGTAAAGGG - Intergenic
1156938652 18:42739588-42739610 GGTTTTAATGAGATTGTAAGGGG - Intergenic
1157607720 18:48936484-48936506 GTCATGAATGGGATTGTAAAAGG - Intronic
1158176563 18:54663688-54663710 GTTGTTGAAATGATTGTAAATGG + Intergenic
1158491854 18:57916971-57916993 ATTGCTAGTGGGAATGTAAATGG - Intergenic
1158880258 18:61771825-61771847 ATTATTGATGGGAATGTAAATGG - Intergenic
1159164596 18:64684566-64684588 GGTTTTAATGGGATGGTAATTGG - Intergenic
1159533695 18:69688084-69688106 GTTTTTCATGGGTTTATAAAAGG - Intronic
1159929326 18:74295365-74295387 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1160344166 18:78117724-78117746 ATTGTTAGTGGGAATGTAAATGG - Intergenic
1161661851 19:5551413-5551435 GGTTTTAATGGGATGGTAATGGG - Intergenic
1161712236 19:5855357-5855379 GGTTTTAATGGGATAGTAACGGG - Intergenic
1162274078 19:9639323-9639345 GGTTTTAATGGGATGGTAAGGGG + Intronic
1162286796 19:9744763-9744785 GGTTTTAATGGGATGGTAAATGG - Intergenic
1162824315 19:13242185-13242207 GTTGTTATTGTTATTGTGAATGG - Intronic
1163056484 19:14723597-14723619 GTTTTTAATGCTGTTGTAAATGG + Intronic
1163487417 19:17596368-17596390 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1163900089 19:20093392-20093414 GGTTTTAATGGGATGGTAATGGG + Intronic
1163944336 19:20521853-20521875 GGTTTTAATGGGATGGTAAGAGG + Intergenic
1164150799 19:22548797-22548819 CTTTTTGATGCGATTGTAAATGG - Intergenic
1164153098 19:22571182-22571204 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1164219301 19:23179026-23179048 GGTTTTAATGGGATAGTAATGGG - Intergenic
1164258878 19:23552186-23552208 GGTTTTAATGGGATGGTAAGGGG - Intronic
1165249362 19:34516922-34516944 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1165284563 19:34831138-34831160 TTTGTAAATGCTATTGTAAATGG - Intergenic
1165533988 19:36427956-36427978 ATTGTTTATGGAAATGTAAATGG - Intergenic
1166413477 19:42573788-42573810 AATGACAATGGGATTGTAAATGG + Intergenic
1166916900 19:46201656-46201678 GGTTTTAATGGGATAGTAACGGG + Intergenic
1166927020 19:46276099-46276121 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1167902271 19:52630709-52630731 GGTTTTAATGGGATGGTAACGGG - Intronic
1168227862 19:55009568-55009590 GGTTTTAATGGGATGGTAACGGG + Intergenic
1168248277 19:55125478-55125500 GGTTTTAATGGGATGGTAAGGGG - Intergenic
926463966 2:13166765-13166787 GGTTTTAATGGGATGGTAATGGG + Intergenic
926520368 2:13903767-13903789 GGTTTTAATGTCATTGTAAATGG + Intergenic
927806792 2:26155070-26155092 GTTGTTTGTGGGATTCTAAATGG + Intergenic
928770291 2:34696785-34696807 GGTTTTAATGGGATGGTAAGGGG - Intergenic
928770699 2:34699864-34699886 GGTTTTAATGGGATGGTAAGGGG + Intergenic
928779589 2:34803737-34803759 GGTTTTAATGGGATGGTAATAGG + Intergenic
928857293 2:35816017-35816039 GGTTTTAATGGGATGGTAAGGGG - Intergenic
928928691 2:36601974-36601996 GATTTTAATGGGATGGTAATGGG - Intronic
929792941 2:45037208-45037230 GGTTTTAATGGGATGGTAACGGG + Intergenic
930237131 2:48899263-48899285 GCTTGTAATGGGATTTTAAAAGG + Intergenic
930291332 2:49496987-49497009 GCTGTTGGTGGGAATGTAAATGG + Intergenic
930326899 2:49931571-49931593 GTTGCTATTGGAATTGAAAAGGG + Intronic
930893273 2:56416009-56416031 TTTGTTGATGCTATTGTAAATGG + Intergenic
930956537 2:57209562-57209584 GTTGTTTAAGTCATTGTAAAGGG - Intergenic
931154293 2:59609665-59609687 CTTTTTAATATGATTGTAAATGG + Intergenic
932199860 2:69815973-69815995 GTTGGTGATGGGGTTGGAAATGG - Intronic
932295968 2:70623569-70623591 GGTTTTAATGGGATGGTAAGGGG - Intronic
932636696 2:73395537-73395559 GTTTTTAATGGTATTGTCAGTGG + Intronic
932806077 2:74784625-74784647 GCTGATGATGAGATTGTAAAAGG - Intergenic
933179645 2:79214589-79214611 GGTTTTAATGGGATGGTAATGGG + Intronic
933517843 2:83328803-83328825 GTTTTTACAGGTATTGTAAAAGG - Intergenic
933552271 2:83791678-83791700 GGTTTTAATGGGATGGTAAAGGG + Intergenic
933849426 2:86353624-86353646 ATTGTTGATGGGAATGTGAAAGG + Intergenic
934580657 2:95435040-95435062 GTTGTGAATGGGAGCTTAAATGG + Intergenic
934598794 2:95641677-95641699 GTTGTGAATGGGAGCTTAAATGG - Intergenic
934877176 2:97934254-97934276 GTCGTAAATGGCGTTGTAAATGG - Intronic
935476921 2:103533914-103533936 GTTGTTACAGCTATTGTAAATGG + Intergenic
935769514 2:106403339-106403361 GTTGTTAATTGGTTTCTGAAAGG - Intronic
935855859 2:107272315-107272337 TTTCTTTATGGGTTTGTAAATGG + Intergenic
935910580 2:107892589-107892611 GTTGTTAATTGGTTTCTGAAAGG + Intergenic
935968700 2:108509443-108509465 GTTGTTAATTGGTTTCTGAAAGG + Intergenic
936132377 2:109857723-109857745 GTTGTTAATTGGTTTCTGAAAGG + Intergenic
936212320 2:110513762-110513784 GTTGTTAATTGGTTTCTGAAAGG - Intergenic
936421460 2:112368329-112368351 GTTGTTAATTGGTTTCTGAAAGG - Intergenic
937896840 2:126982984-126983006 TTTTTTGATGGTATTGTAAATGG - Intergenic
938962646 2:136356974-136356996 GTTGGTAGGGGGTTTGTAAAAGG - Intergenic
939460620 2:142492615-142492637 GGTTTTAATGGGATGGTAAGGGG + Intergenic
940183818 2:150961244-150961266 GGTTTTAATGGGATAGTAATGGG - Intergenic
940365284 2:152841775-152841797 GTTTTTGATGGCATTGTAAATGG + Intergenic
941374164 2:164706919-164706941 GTTGTTAATGGACTTATAAAGGG - Intronic
941456069 2:165713273-165713295 GGTTTTAATGGGATGGTAATGGG + Intergenic
941601856 2:167552438-167552460 GTTGTTTATGGAAATTTAAATGG - Intergenic
942167655 2:173257750-173257772 ATTGTTGGTGGGAATGTAAATGG - Intronic
943061687 2:183046824-183046846 GGTTTTAATGGGATGGTAAGGGG - Intergenic
943450248 2:188036146-188036168 GGTTTTAATGGGATGGTAAGGGG - Intergenic
943461078 2:188171976-188171998 GGTTTTAATGGGATGGTAAGGGG + Intergenic
943835515 2:192510412-192510434 GGTTTTAATGGGATGGTAAGGGG - Intergenic
943865457 2:192920997-192921019 GATTTTAATGGGATGGTAAGGGG - Intergenic
943892334 2:193305936-193305958 GTTGTTATATGGATTGTAGATGG - Intergenic
944868532 2:203885825-203885847 ATTGTTAATGGGTTTGTCACTGG + Intergenic
944876003 2:203964689-203964711 GGTTTTAATGGGATGGTAAGGGG + Intergenic
945173575 2:207020185-207020207 GGTTTTAATGGGATGGTAAGTGG - Intergenic
945237895 2:207649453-207649475 GTTGCTAATGGGAATGTAAATGG + Intergenic
945301366 2:208219008-208219030 GGTTTTAATGGGATGGTAATGGG + Intergenic
945361762 2:208902175-208902197 GGTTTTAATGGGATGGTAAGGGG - Intergenic
945554810 2:211264406-211264428 GGTTTTAATGGGATGGTAAGCGG - Intergenic
946214914 2:218176809-218176831 GTTTTTAATGAGATGGTAAGGGG + Intergenic
946833369 2:223747518-223747540 CTTGTTGATGTGATTGTACAAGG - Intergenic
947266804 2:228291775-228291797 GTGGATAATGGTGTTGTAAATGG - Intergenic
947913022 2:233814013-233814035 GCTGTCAATGGGAGTGGAAATGG + Intronic
948758109 2:240170982-240171004 GCTGTTAATTGGATTGTGCAGGG + Intergenic
1168739410 20:175170-175192 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1168943156 20:1730515-1730537 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1169310050 20:4529489-4529511 ATTGTTAATGCTATTATAAATGG - Intergenic
1170175354 20:13462767-13462789 CTTTTTAATGCTATTGTAAATGG - Intronic
1170176807 20:13480094-13480116 TTTGGAAATGGGATTGAAAAAGG - Intronic
1170496449 20:16929757-16929779 ATTGTGAAGGGGATTGTGAAGGG + Intergenic
1170680313 20:18520371-18520393 GGTTTTAATGGGATAGTAATGGG + Intronic
1171415407 20:24976581-24976603 ATTGTTAATGGGAAGGCAAATGG + Intronic
1172258993 20:33545369-33545391 GTTATTAGTGGGATTGTTAGTGG + Intronic
1173363288 20:42363608-42363630 GTTGTTAATATTATTGTAATAGG - Intronic
1173652170 20:44673296-44673318 GGTTTTAATGGGATAGTAATGGG - Intergenic
1173763652 20:45586969-45586991 GGTTTTAATGGGATGGTAATGGG + Intergenic
1173781855 20:45762733-45762755 GGTTTTAATGGGATGGTAATGGG - Intronic
1175228880 20:57461031-57461053 GTGGTTAATGGGCATGTAGAAGG + Intergenic
1175535517 20:59708301-59708323 GTTGATCATGGGATAGCAAAGGG + Intronic
1175792591 20:61750868-61750890 GTTTTTAATGCTATTGTAATTGG - Intronic
1177031054 21:15982565-15982587 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1177119687 21:17124431-17124453 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1178444526 21:32626772-32626794 ATTGCTGATGGGAATGTAAAAGG + Intergenic
1178519251 21:33274053-33274075 GTTCTTAATGGCATTTTGAATGG + Intronic
1179378495 21:40875988-40876010 TTTTTTAATGCTATTGTAAATGG - Intergenic
1179650250 21:42803817-42803839 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1181004358 22:20004114-20004136 CTTTTTAATGGTATTGTAAATGG - Intronic
1181817206 22:25447602-25447624 GTTGTAAATGGGAATTTATAGGG - Intergenic
1182998721 22:34837251-34837273 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1183276936 22:36904422-36904444 GTGTTCTATGGGATTGTAAATGG - Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183635542 22:39060249-39060271 GGTTTTAATGGGATGGTAAGGGG + Intronic
1184825012 22:46944136-46944158 TTTGCTGATGGGATGGTAAATGG - Intronic
949893460 3:8750980-8751002 ATTGTTGGTGGGAATGTAAATGG - Exonic
950944329 3:16928993-16929015 GTTGTGAATGGGATTGGGCAGGG + Intronic
951269214 3:20604136-20604158 GTTGTGCATGGCATTGGAAAAGG + Intergenic
951888865 3:27550901-27550923 GGTTTTAATGGGATGGTAAGTGG + Intergenic
952243021 3:31553160-31553182 ATTGCTGATGGGAGTGTAAATGG + Intronic
952297001 3:32070540-32070562 GGTTTTAATGGGATAGTAATGGG - Intronic
952663343 3:35877098-35877120 GGTTTTAATGGGATGGTAAGGGG + Intergenic
952895096 3:38073439-38073461 GGTTTTAATGGGATGGTAATAGG + Intronic
953077002 3:39580571-39580593 GGTTTTAATGGGATGGTAATGGG + Intergenic
953104770 3:39866447-39866469 ATTTTTGATGTGATTGTAAATGG - Intronic
953177326 3:40563915-40563937 GGTTTTAATGGGATGGTAATGGG - Intronic
953551847 3:43909180-43909202 GATGTTAATGGGAAGGAAAAGGG + Intergenic
953599312 3:44347798-44347820 GTTTTTAATGGGATGGTAAGGGG + Intronic
954820840 3:53326179-53326201 AATGTTAATGGGATTGTGGAAGG - Intronic
955113914 3:55977622-55977644 ATTGTTGATGGGTCTGTAAATGG + Intronic
955253489 3:57306620-57306642 GGTTTTAATGGGATGGTAAGGGG - Intronic
956568467 3:70666677-70666699 GGTTTTAATTGGATTCTAAAAGG - Intergenic
957000730 3:74881191-74881213 TTTGTTAATGGATTTGTCAAGGG + Intergenic
957154991 3:76535424-76535446 GGTTTTAATGGGATGGTAAGGGG + Intronic
957317181 3:78585916-78585938 GTTTTTAATGAGATGGTAAGGGG + Intergenic
957451559 3:80387818-80387840 GGTTTTAATGGGATAGTAATGGG - Intergenic
957675134 3:83355934-83355956 GGTTTTAATGGGATAGTAATGGG + Intergenic
957904734 3:86541156-86541178 GGTTTTAATGGGATAGTAATGGG + Intergenic
958751105 3:98193873-98193895 GGTTTTAATGGGATAGTAATGGG - Intronic
959044765 3:101461556-101461578 ATTGCTAGTGGGAATGTAAATGG + Intronic
959384257 3:105682451-105682473 GTTTTTAATGTGTTTGTAAAGGG + Intronic
959423079 3:106151804-106151826 ATTGTGAGTGGGATTATAAAAGG - Intergenic
959596312 3:108132731-108132753 GTTCTGAATTGGATTTTAAAAGG + Intergenic
959794494 3:110408049-110408071 TTTGTTCATGTCATTGTAAATGG + Intergenic
960906512 3:122606954-122606976 GTAGTTAATGGGATGGCAGAGGG + Intronic
961388913 3:126540808-126540830 GTTGCTGGTGGGAGTGTAAAGGG - Intronic
961996312 3:131247888-131247910 GTTCTTAATGTGATTGTTATTGG + Intronic
962030347 3:131593409-131593431 GTTCTTGATGCTATTGTAAAAGG + Intronic
962509987 3:136088691-136088713 ACTGTTAGTGGGAATGTAAATGG - Intronic
962660756 3:137598415-137598437 GGTTTTAATGGGATGGTAACGGG - Intergenic
963058747 3:141207907-141207929 GGTTTTAATGGGATGGTAACGGG - Intergenic
963283895 3:143413926-143413948 GTGTTTAATGGGATTTTTAAAGG - Intronic
963425339 3:145115922-145115944 GGTTTTAATGGGATGGTAAGGGG - Intergenic
963429761 3:145184661-145184683 ATTGTTAGTGAGAATGTAAATGG - Intergenic
963456542 3:145553957-145553979 GGTTTTAATGGGATGGTAATGGG + Intergenic
963468726 3:145713335-145713357 GGTTTTAATGAGATTGTAAGGGG - Intergenic
963891758 3:150643858-150643880 GTTTTTGATGCTATTGTAAATGG - Intergenic
964152577 3:153545250-153545272 ATTGTAAATGGGCTTGAAAAAGG + Intergenic
964174832 3:153814951-153814973 GTTTTTGATGTTATTGTAAATGG - Intergenic
964175915 3:153826050-153826072 GGTTTTAATGGGATGGTAAGGGG + Intergenic
964185881 3:153942012-153942034 GTTCTTAATGGCATTTAAAATGG + Intergenic
964300132 3:155277955-155277977 GGTTTTAATGGGATGGTAAGGGG + Intergenic
964906401 3:161724657-161724679 GGTTTTAATGGGATGGTAAGGGG + Intergenic
964984761 3:162725296-162725318 GGTTTTAATGGGATGGTAATGGG + Intergenic
965070447 3:163910485-163910507 GATTTTAATGGGATGGTAAGGGG - Intergenic
965105116 3:164344902-164344924 GGTTTTAATGGGATGGTAAGGGG + Intergenic
965335223 3:167425534-167425556 GGTTTTAATGGGATAGTAATGGG - Intergenic
965713538 3:171579356-171579378 GGTTTTAATGGGATGGTAATGGG - Intergenic
966279424 3:178210475-178210497 GGTTTTAATGGGATGGTAAGGGG - Intergenic
966398318 3:179523703-179523725 GGTTTTAATGGGATAGTAATGGG + Intergenic
967005232 3:185377317-185377339 GGTTTTAATGGGATGGTAAGGGG + Intronic
967152244 3:186660956-186660978 GGTTTTAATGGGATGGTAAGGGG - Intronic
967227783 3:187309206-187309228 TATTTTTATGGGATTGTAAATGG + Intergenic
967643699 3:191898127-191898149 GGTTTTAATGGGATGGTAAGGGG + Intergenic
967657986 3:192073858-192073880 GGTTTTAATGGGATGGTAATGGG + Intergenic
967740598 3:192998624-192998646 GGTTTTAATGGGATGGTAAGGGG - Intergenic
968529239 4:1081720-1081742 GTTCTTACTGGGTTTGCAAACGG + Intronic
969207070 4:5655163-5655185 GTTCTTATGGGGTTTGTAAAGGG - Intronic
969411038 4:7028347-7028369 GTTATTAATGGGATGGTGATAGG + Intronic
969653965 4:8485550-8485572 GGTTTTAATGGGATGGTAATGGG + Intronic
970042204 4:11809216-11809238 GGTTTTAATGGGATGGTAAGGGG - Intergenic
970110300 4:12630167-12630189 GGTGTTATTGGGATTGTCACTGG - Intergenic
970310106 4:14773493-14773515 GTTGTTATAGCTATTGTAAATGG - Intergenic
970853933 4:20633067-20633089 GGTTTTAATGGGATGGTAAGGGG + Intergenic
970932373 4:21527687-21527709 GTTTTTCAAGGCATTGTAAATGG - Intronic
971458135 4:26863127-26863149 GTCTTAAAAGGGATTGTAAATGG - Intronic
971544137 4:27862985-27863007 ATTGCTGATGGGAATGTAAAGGG + Intergenic
972241098 4:37193203-37193225 GTTTTTGGTGAGATTGTAAAAGG - Intergenic
972383563 4:38541844-38541866 GTTCTTAATGGCATTGAGAATGG + Intergenic
973751242 4:54022741-54022763 GGTTTTAATGGGATGGTAAGGGG - Intronic
974135828 4:57816684-57816706 ATTGCTGATGGGATTGAAAAAGG + Intergenic
974903896 4:68033546-68033568 GGTTTTAATGGGATAGTAATGGG - Intergenic
975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG + Intronic
975152248 4:71034465-71034487 GGTTTTAATGGGATGGTAAGGGG - Intergenic
976759584 4:88533803-88533825 TTTATTATTGGGATTTTAAAGGG - Intronic
977104763 4:92867620-92867642 GTAGTTAATGTGTTGGTAAAAGG + Intronic
977225224 4:94386242-94386264 GGTTTTAATGGGATGGTAATGGG + Intergenic
977446319 4:97137378-97137400 GGTTTTAATGGGATGGTAAGGGG + Intergenic
977782323 4:100994556-100994578 GGTTTTAATGGGATGGTAAGGGG + Intergenic
978003800 4:103591504-103591526 GTAGATGATGGGATTGTACATGG + Exonic
978031599 4:103944074-103944096 GGTTTTAATGGGATGGTAAGGGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979171294 4:117603088-117603110 GGTTTTAATGGGATGGTAAGGGG + Intergenic
980111804 4:128643639-128643661 GGTTTTAATGGGATGGTAATGGG + Intergenic
980196400 4:129594230-129594252 GTTTTTAATACTATTGTAAATGG - Intergenic
980491238 4:133531970-133531992 GGTTTTAATGGGATGGTAAAGGG + Intergenic
980575508 4:134680685-134680707 GGTTTTAATGGGATGGTAATGGG + Intergenic
980714529 4:136613216-136613238 GGTTTTAATGGGATGGTAAGGGG - Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
981352555 4:143749837-143749859 GTTAATTATGGGATTGTAAAGGG - Intergenic
981525332 4:145702027-145702049 GGTTTTAATGGGATGGTAATGGG - Intronic
982318932 4:154059212-154059234 GGTTTTAATGGGATAGTAATAGG - Intergenic
982496989 4:156106254-156106276 GGTTTTAATGGGATGGTAATGGG + Intergenic
982633214 4:157858951-157858973 GTGGTAAATGGAATTGTATAAGG + Intergenic
983023996 4:162712036-162712058 GGTTTTAATGGGATGGTAATGGG - Intergenic
983056506 4:163103567-163103589 GGTTTTAATGGGATGGTAAGGGG + Intergenic
983545586 4:168960093-168960115 GTTTTTAATGCTACTGTAAATGG + Intronic
984222838 4:176999326-176999348 GCAGTTTGTGGGATTGTAAATGG + Intergenic
984411856 4:179406222-179406244 GGTTTTAATGGGATGGTAAGGGG - Intergenic
984700796 4:182817457-182817479 GGTTTTAATGGGATGGTAAGGGG - Intergenic
985078888 4:186244886-186244908 GGTTTTAATGGGATGGTAAGGGG + Intronic
985366675 4:189238201-189238223 GTTGTAAAAGAGATTGTAACTGG - Intergenic
985388799 4:189472816-189472838 GTTTTTAATGTTATCGTAAATGG + Intergenic
985582469 5:705724-705746 GGTTTTAATGGGATGGTAATGGG - Intergenic
986368859 5:7061087-7061109 GGTTTTAATGGGATAGTAATGGG + Intergenic
987163070 5:15165233-15165255 AATGTTAATGGGAATGTAAAGGG + Intergenic
987897414 5:23965427-23965449 GATTTTAATGTTATTGTAAATGG - Intronic
988058192 5:26128787-26128809 GTTTTTAATTGGATTGCTAATGG + Intergenic
988451751 5:31350912-31350934 GTTGTTGATGGAATTTTAGAGGG + Intergenic
989013130 5:36896969-36896991 CTTTTTAATGCTATTGTAAATGG + Intronic
989202691 5:38780863-38780885 CTTGTGAATGGGATTTTATAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990681528 5:58249968-58249990 GCTGTTAGTGTGAGTGTAAATGG - Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991164701 5:63551664-63551686 TTTGTTGGTGGTATTGTAAATGG + Intergenic
991318961 5:65346938-65346960 TTTTTTAATGGTATTGTAAATGG - Intronic
992315707 5:75551758-75551780 GTTGCTGATGGGATTTAAAATGG + Intronic
992451882 5:76883161-76883183 GGTTTTAATGGGATGGTAAGGGG + Intronic
992725584 5:79603859-79603881 GCTGTTAATCAGATTATAAAGGG + Intergenic
992881539 5:81115222-81115244 GTAGTTAATGGAATTTTAACTGG + Intronic
993304487 5:86258005-86258027 ACTGTTGATGGGATTGTAAATGG + Intergenic
993530408 5:89017616-89017638 ATTGTGAATGGGACTGGAAATGG + Intergenic
994125989 5:96169661-96169683 GGTTTTAATGGGATGGTAAGGGG + Intergenic
994375665 5:99014094-99014116 GGTTTTAATGGGATGGTAAGGGG + Intergenic
994802102 5:104391537-104391559 CTTCTAAATGGGATTTTAAAAGG - Intergenic
995265831 5:110159233-110159255 ATTGCTAGTGGGAGTGTAAATGG + Intergenic
995769505 5:115653470-115653492 GGTTTTAATGGGATGGTAAGGGG - Intergenic
995899251 5:117049149-117049171 GGTCTTAATGGGATGGTAACGGG + Intergenic
996358496 5:122621641-122621663 GGTTTTAATGGGATGGTAATGGG + Intergenic
996510015 5:124306726-124306748 GGTTTTAATGAGATTGTAAGGGG - Intergenic
996528168 5:124499988-124500010 GGTTTTAATGGGATGGTAAGGGG - Intergenic
996574872 5:124969382-124969404 GGTTTTAATGGGATGGTAAGGGG + Intergenic
996584972 5:125076991-125077013 TTTTTTAATGCTATTGTAAAAGG - Intergenic
996917795 5:128732440-128732462 GGTTTTAATGGGATGGTAAGGGG - Intronic
997157419 5:131574806-131574828 GGTTTTAATGGGATGGTAAGGGG - Intronic
997293937 5:132758065-132758087 GTTTTTACTGTGAATGTAAATGG - Intronic
997343547 5:133167117-133167139 GTTTTTGATGCTATTGTAAATGG + Intergenic
997678685 5:135734141-135734163 GGTTTTAATGGGATAGTAATGGG + Intergenic
999413325 5:151371961-151371983 GTTGTTAATGTGCTATTAAAAGG - Intergenic
999874277 5:155784927-155784949 ATTGCTGATGGGAATGTAAATGG + Intergenic
999915946 5:156260475-156260497 GTTTTTGATGCTATTGTAAATGG + Intronic
999985407 5:156999743-156999765 CTTGCTAATGGGAATATAAATGG + Intergenic
1000099857 5:158005413-158005435 ATAGTTGATGGGAATGTAAATGG - Intergenic
1000120987 5:158197709-158197731 GTTGAAAAGGGGATTGGAAAAGG - Intergenic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1000283612 5:159805711-159805733 CTTTTTAATGCTATTGTAAATGG - Intergenic
1000540592 5:162534801-162534823 GTTATTAATGCTATTATAAATGG - Intergenic
1000607057 5:163336958-163336980 GGTTTTAATGGGATAGTAATGGG - Intergenic
1000935518 5:167300664-167300686 GGTTTTAATGGGATGGTAAGGGG + Intronic
1001331331 5:170764818-170764840 GGTTTTAATGGGATGGTAACGGG + Intronic
1002610832 5:180417499-180417521 GGTTTTAATGGGATGGTAATGGG + Intergenic
1002692260 5:181058772-181058794 GTTTTTAAAAGGATTTTAAAAGG - Intronic
1003003718 6:2361285-2361307 GTTGCTAATGGGAGTGCAACTGG + Intergenic
1004863124 6:19826385-19826407 CTTGCTAATGGGATGGTACATGG - Intergenic
1005715801 6:28546821-28546843 CTTGTTGATGCTATTGTAAATGG + Intergenic
1006324965 6:33346762-33346784 GGTTTTAATGGGATAGTAATGGG - Intergenic
1007084574 6:39134375-39134397 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1007300854 6:40866980-40867002 GGTTTTAATGGGATAGTAATGGG + Intergenic
1007754615 6:44090878-44090900 ATTGCTAGTGGGAATGTAAAAGG + Intergenic
1008173668 6:48239714-48239736 CTTTTTAATGGGATTGTTAATGG - Intergenic
1008189796 6:48440376-48440398 ATTTTTAATGAGATTGTAAATGG - Intergenic
1008224314 6:48894462-48894484 ATTTTTGATGGAATTGTAAATGG + Intergenic
1008453285 6:51678251-51678273 ATTGTCAAAGGGATTGGAAATGG + Intronic
1008476649 6:51941119-51941141 GGTTTTAATGGGATGGTAAAGGG - Intronic
1008850090 6:56013591-56013613 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1009269935 6:61603041-61603063 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1009750197 6:67871797-67871819 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1009751971 6:67886557-67886579 TTTGTTAATGGGATGATAAGGGG + Intergenic
1009948941 6:70372800-70372822 GTTGCTGGTGGGAATGTAAAAGG - Intergenic
1010348564 6:74842888-74842910 ATTGTTAATGGAAATGTAAAGGG - Intergenic
1011162572 6:84408242-84408264 GTTATTGACGTGATTGTAAATGG + Intergenic
1011367782 6:86601147-86601169 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1012233677 6:96788384-96788406 GTGGTTAATTGGATTTTAAGAGG - Intergenic
1012577348 6:100819324-100819346 GTTTTTGATGCTATTGTAAATGG - Intronic
1012689696 6:102295865-102295887 GGTTTTAATGGGATGGTAATGGG - Intergenic
1013900011 6:115143850-115143872 GTTGGTAATGAGATTGCAGATGG - Intergenic
1014396187 6:120928111-120928133 GGTTTTAATGAGATTGTAAGGGG - Intergenic
1015444921 6:133292522-133292544 GTTGATGTTGGGATTTTAAACGG + Intronic
1015995452 6:138991609-138991631 CTTGTTATTGGGTTTGCAAAGGG + Intergenic
1016535639 6:145105926-145105948 GGTTTTAATGAGATTGTAAGGGG + Intergenic
1016650170 6:146453197-146453219 GGTTTTAATGGGATGGTAATGGG + Intergenic
1016861746 6:148727153-148727175 ATTTTTAATGTGATTATAAATGG - Intergenic
1017269929 6:152493146-152493168 GATTTTAATGGGATAGTAATGGG - Intronic
1017287505 6:152693268-152693290 CTTTTTAATGCTATTGTAAATGG + Intergenic
1017779220 6:157703428-157703450 GGTTTTAATGGGATGGTAAGGGG + Intronic
1017922699 6:158885804-158885826 GGTTTTAATGGGATAGTAATGGG + Intronic
1018077730 6:160231433-160231455 GATTTTAATGGGATAGTAATGGG - Intronic
1018406061 6:163483802-163483824 GTTCTTAATGGCATTGAGAATGG + Intronic
1018466127 6:164047276-164047298 ATTTTTGATGCGATTGTAAATGG + Intergenic
1018521350 6:164654930-164654952 GGTTTTAATGGGATGGTAATGGG + Intergenic
1019885757 7:3903513-3903535 ATTGTTTATAGGATTGTAAAAGG + Intronic
1020675521 7:11179467-11179489 ACTGTTGATGGGAATGTAAATGG - Intergenic
1020794335 7:12662496-12662518 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1021288258 7:18809759-18809781 ACTGTTAATGGGAATCTAAATGG + Intronic
1021637437 7:22706177-22706199 GGTTTTAATGGGATGGTAATGGG - Intergenic
1021660743 7:22916044-22916066 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1021816249 7:24450073-24450095 GTTCTGAATGGGCTTGAAAATGG + Intergenic
1022372996 7:29787776-29787798 GGTTTTAATGGGATGGTAACGGG - Intergenic
1022709192 7:32835309-32835331 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1023310373 7:38880396-38880418 CTTGTTATTAGGAATGTAAAAGG + Intronic
1023463858 7:40431684-40431706 GTTTTTCATGTTATTGTAAATGG + Intronic
1024309603 7:47957838-47957860 TTTTTTAATTGTATTGTAAATGG - Intronic
1025167326 7:56723858-56723880 ATTGGTACTGGGAATGTAAAAGG + Intergenic
1026018516 7:66690781-66690803 GTTATTAAAAGGATTGTATAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027158438 7:75784861-75784883 GGTTTTAATGGGATGGTAAGGGG - Intronic
1027354544 7:77342631-77342653 GGTTTTAATGGGATGGTAAGGGG - Intronic
1028589776 7:92482560-92482582 GGTTTTAATGGGATAGTAATGGG + Intergenic
1029500324 7:100925096-100925118 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1030445675 7:109644937-109644959 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1030561616 7:111093961-111093983 GTTGTTAATGGCTTAATAAACGG + Intronic
1031244032 7:119283840-119283862 CTTCTTAATGTGATTGAAAAAGG - Intergenic
1031364638 7:120888393-120888415 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1031422342 7:121566751-121566773 GGTTTTAATGGGATGGTAACGGG + Intergenic
1031610623 7:123822390-123822412 ATTTTTAATGGTATTGTAAATGG + Intergenic
1031777455 7:125920510-125920532 GGTTTTAATGAGATTGTAAGGGG - Intergenic
1031889445 7:127277194-127277216 GTCCTGAATGGTATTGTAAAGGG - Intergenic
1032427519 7:131833542-131833564 GTTGATAATGGGATGGGAAATGG + Intergenic
1032805976 7:135354677-135354699 GCTGATAAAGGGATTGAAAATGG - Intergenic
1033211637 7:139464226-139464248 GGTTTTAATGGGATGGTAAGGGG - Intronic
1033464924 7:141581600-141581622 GGTTTTAATGGGATGGTAAGGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034084705 7:148312823-148312845 GGTTTTAATGGGATGGTAAGGGG + Intronic
1034905178 7:154938345-154938367 CTTTTTAATGCTATTGTAAATGG + Intronic
1035197448 7:157233798-157233820 ATTGTTGGTGGGATTGTAAAAGG - Intronic
1035956657 8:4088052-4088074 ATTGTTACTGTGATTGTCAAAGG - Intronic
1036070800 8:5439413-5439435 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1036549789 8:9805878-9805900 GGTTTTAATGGGATAGTAATGGG - Intergenic
1037119032 8:15261264-15261286 GTCACTAATGGGATTGTAAAGGG - Intergenic
1038074998 8:24062344-24062366 ATTGTTGCTGGGAATGTAAATGG + Intergenic
1039498882 8:38001453-38001475 GGTTTTAATGGGATAGTAATGGG + Intergenic
1039652780 8:39360325-39360347 GTTCTTAATGGTATTTTAAATGG - Intergenic
1040515842 8:48134129-48134151 ATTGTTAGTGGAAATGTAAAAGG - Intergenic
1040648136 8:49422442-49422464 GGTTTTAATGGGATTGTAAGGGG - Intergenic
1041651731 8:60309278-60309300 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1041658951 8:60382328-60382350 GGTGTTTATTGGATTTTAAATGG - Intergenic
1041917424 8:63151108-63151130 GGTGTTAATGGGATGGTAAGGGG + Intergenic
1042209726 8:66368081-66368103 CTTGAAAATGGCATTGTAAATGG - Intergenic
1042706197 8:71667301-71667323 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1043067135 8:75588543-75588565 TTTTTTAATGTTATTGTAAAGGG + Intergenic
1043096707 8:75984614-75984636 GTTGTAAATGGGATTTTTTATGG + Intergenic
1043353546 8:79388878-79388900 GGTTTTAATGGGATGGTAATGGG + Intergenic
1043417040 8:80061815-80061837 CTTGTTGATGTGATTGTAAATGG - Intronic
1043717780 8:83507924-83507946 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1043721022 8:83546889-83546911 GCTTTTAATGGGATTATAAGGGG - Intergenic
1043837844 8:85065906-85065928 GGTTTTAATGGGATGGTAATGGG - Intergenic
1044147221 8:88732134-88732156 CTTATGAATGGGATTATAAAAGG + Intergenic
1044148397 8:88744986-88745008 GGTTTTAATGAGATGGTAAAGGG + Intergenic
1044149450 8:88756511-88756533 GTTTTTAGTGCTATTGTAAATGG + Intergenic
1044175513 8:89115975-89115997 ATTTTTGATGCGATTGTAAATGG - Intergenic
1044177523 8:89146827-89146849 GTTGCTAGTGGCATTGTAGATGG - Intergenic
1044417212 8:91950897-91950919 GGTTTTAATGGGATGGTAATGGG - Intergenic
1044513114 8:93107078-93107100 GTTGTCAATTGGAATGTAACTGG - Intergenic
1046111187 8:109727505-109727527 GCTGTTAGTAGGAATGTAAATGG + Intergenic
1046558408 8:115806379-115806401 GTTGCAAATTGGATTGTAATTGG + Intronic
1047856497 8:128917350-128917372 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1048097718 8:131313131-131313153 GTTTTTAATGGGATGGTAAGGGG - Intergenic
1048135580 8:131743658-131743680 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1049608721 8:143542032-143542054 GCTGTTGGTGGGAATGTAAATGG + Intergenic
1050392271 9:5156883-5156905 TTTTTTAATGCTATTGTAAATGG - Intronic
1050877387 9:10655587-10655609 AATGTTAATGGTATTGTTAAAGG - Intergenic
1050896198 9:10887707-10887729 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1051134339 9:13901283-13901305 GTTATTACTGGGATTGAACATGG - Intergenic
1051474668 9:17492627-17492649 GTTGCTAATGATAATGTAAAAGG + Intronic
1051953289 9:22661343-22661365 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1052163204 9:25290603-25290625 GGTTGTAATGGGATGGTAAAGGG - Intergenic
1052191951 9:25671858-25671880 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1052434745 9:28411865-28411887 ACTGTTAATGGGATTTAAAATGG - Intronic
1053059806 9:35022120-35022142 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1053464751 9:38297560-38297582 GATGTCAAGGGGATTTTAAAAGG + Intergenic
1053565767 9:39249016-39249038 TTTGTTGGTGGGAATGTAAATGG - Intronic
1054131385 9:61370022-61370044 TTTGTTGGTGGGAATGTAAATGG + Intergenic
1054599016 9:67100580-67100602 TTTGTTGGTGGGAATGTAAATGG + Intergenic
1055347595 9:75354557-75354579 GGTTTTAATGGGATAGTAAAGGG + Intergenic
1056363825 9:85883623-85883645 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1056868374 9:90252720-90252742 GTTGTTGTTGTTATTGTAAATGG + Intergenic
1057043032 9:91860995-91861017 TTTTTTAATGCTATTGTAAATGG - Intronic
1057552030 9:96058511-96058533 TTTGCTAATGGGAATGCAAATGG + Intergenic
1057812467 9:98268585-98268607 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1058026084 9:100143467-100143489 GGTTTTAATGGGATGGTAAGGGG + Intronic
1058159068 9:101548057-101548079 TTTTTTAATGGTATTGTAAATGG - Intronic
1058612514 9:106791135-106791157 GGTTTTAATGGGATGGTAATGGG - Intergenic
1059546057 9:115177396-115177418 GGTTTTAATGGGATGGTAAGGGG + Intronic
1059829522 9:118079131-118079153 GTTTTTAATGCTATTGTAAATGG - Intergenic
1060226333 9:121793263-121793285 GGTTTTAATGGGATGGTAATGGG - Intergenic
1060258928 9:122056825-122056847 GTTGGGAATGGGAGTATAAACGG + Intronic
1060318352 9:122533410-122533432 GGTTTTAATGGGATGGTAAGTGG + Intergenic
1060511384 9:124236212-124236234 GTTTTTAATGCTATTGTAAGTGG - Intergenic
1060774224 9:126358552-126358574 ATTGTTGATGCTATTGTAAATGG + Intronic
1061019948 9:128007957-128007979 GTTGTTTTTGAGTTTGTAAAGGG - Intergenic
1186112732 X:6274958-6274980 GGTTTTAATGGGATGGTAATGGG + Intergenic
1186658652 X:11644733-11644755 ATTGTTGATGGGAATGAAAATGG + Intronic
1186784193 X:12942773-12942795 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1187030428 X:15482002-15482024 TGTGTTAATGTGATTGTGAATGG - Intronic
1187099850 X:16181942-16181964 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1187103652 X:16219602-16219624 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1188200841 X:27291915-27291937 GGTTTTAATGGGATAGTAATGGG + Intergenic
1188218594 X:27511901-27511923 GTTGTTGTTGCTATTGTAAATGG - Intergenic
1188552776 X:31380438-31380460 GGTTTTAATGGGATGGTAAGGGG - Intronic
1188853498 X:35161998-35162020 ATTGTTGCTGGGAGTGTAAATGG + Intergenic
1189742847 X:44139016-44139038 TTTGTTAATGCCAATGTAAATGG - Intergenic
1190465809 X:50724076-50724098 GGTTTTAATGGGATCGTAAGGGG - Intronic
1190857044 X:54306193-54306215 GTTGTTGATGGGAATATAAATGG + Intronic
1191014069 X:55791083-55791105 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1191029840 X:55957640-55957662 ATTGTTGATGCTATTGTAAATGG + Intergenic
1191107814 X:56783103-56783125 GCTGTAAATGGGGCTGTAAATGG + Intergenic
1191844767 X:65538833-65538855 ATTGTTAATCGTATTGTCAAAGG + Intergenic
1192272574 X:69596701-69596723 ATTGCTGATGGGAATGTAAATGG + Intergenic
1192706263 X:73530611-73530633 GGTTTTAATGGGATAGTAATGGG - Intergenic
1192764462 X:74127575-74127597 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1192778327 X:74268144-74268166 GGTGCAAATGGGATGGTAAAGGG - Intergenic
1193088227 X:77466862-77466884 GTTGTTGCTGCTATTGTAAATGG + Intergenic
1193886046 X:86984735-86984757 GGTTTTAATGGGATGGTAATGGG - Intergenic
1194293501 X:92103017-92103039 GGTTTTAATGGGATGGTAATGGG + Intronic
1194502861 X:94701596-94701618 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1195205259 X:102593271-102593293 ATTCTTAATGGTATTATAAATGG + Intergenic
1195291041 X:103432306-103432328 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1195431320 X:104792623-104792645 GTAGATCATGGGATTGAAAAGGG + Intronic
1195499581 X:105579552-105579574 GTTGTTAGTAGTAGTGTAAATGG - Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195600138 X:106737524-106737546 GTTGTTAATAGCATTGTTTAGGG + Intronic
1195841613 X:109181356-109181378 GGTTTTAATGAGATTGTAAGGGG - Intergenic
1196087445 X:111700137-111700159 GTTGCTATTGCTATTGTAAATGG + Intronic
1196102554 X:111862929-111862951 GTTTTTAATGCTACTGTAAATGG + Intronic
1196585229 X:117420561-117420583 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1196703130 X:118693153-118693175 CTTTTTAATGCTATTGTAAATGG + Intergenic
1196938845 X:120755860-120755882 GTTGTTACAGGGATTGCATAAGG - Intergenic
1196992562 X:121345768-121345790 GGTTTTAATGGGATGGTAATGGG + Intergenic
1197139998 X:123107168-123107190 TTTGAAAATGGAATTGTAAAGGG + Intergenic
1197351934 X:125391619-125391641 GGTTTTAATGAGATGGTAAAGGG + Intergenic
1197354150 X:125415030-125415052 GTTTTTAATGTTATTGTAAAAGG + Intergenic
1197499837 X:127229527-127229549 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1197875966 X:131106890-131106912 ATTTTTAATGCTATTGTAAATGG + Intergenic
1197933204 X:131715007-131715029 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1197987419 X:132280960-132280982 ATTTTTGATGGTATTGTAAATGG + Intergenic
1198208618 X:134494317-134494339 GTTTTTAATGAAATTATAAAAGG - Intronic
1198598562 X:138261744-138261766 GGTTTTAATGGGATGGTAAGGGG - Intergenic
1198726575 X:139684368-139684390 GTTGATGGTGGGAATGTAAAAGG + Intronic
1198993659 X:142547218-142547240 ATGGTTAATGGGAATGTACAAGG + Intergenic
1199811133 X:151350443-151350465 GTTTTTGATGCTATTGTAAATGG - Intergenic
1201234141 Y:11893911-11893933 GGTGTTAACGGGATGGTAAGGGG + Intergenic
1201724695 Y:17139474-17139496 GGTTTTAATGGGATGGTAAGGGG + Intergenic
1201794756 Y:17882929-17882951 GTTGTTAAAAGGGTTGTAAGGGG + Intergenic
1201806799 Y:18023056-18023078 GTTGTTAAAAGGGTTGTAAGGGG - Intergenic
1202062207 Y:20899509-20899531 GGTTTTAATGGGATAGTAATGGG - Intergenic
1202356131 Y:24050708-24050730 GTTGTTAAAAGGGTTGTAAGGGG + Intergenic
1202514647 Y:25619401-25619423 GTTGTTAAAAGGGTTGTAAGGGG - Intergenic