ID: 975147062

View in Genome Browser
Species Human (GRCh38)
Location 4:70980143-70980165
Sequence GAGTGTGTACAGGGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975147062_975147069 22 Left 975147062 4:70980143-70980165 CCATCTTCCCCCTGTACACACTC 0: 1
1: 0
2: 3
3: 50
4: 447
Right 975147069 4:70980188-70980210 TACCTATATAAACATACTTTAGG 0: 1
1: 1
2: 0
3: 28
4: 306
975147062_975147067 -10 Left 975147062 4:70980143-70980165 CCATCTTCCCCCTGTACACACTC 0: 1
1: 0
2: 3
3: 50
4: 447
Right 975147067 4:70980156-70980178 GTACACACTCCTCACACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975147062 Original CRISPR GAGTGTGTACAGGGGGAAGA TGG (reversed) Intronic
900307964 1:2020055-2020077 GAGTGTGTGCAGGTGGACGGCGG + Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901644000 1:10706909-10706931 GGCTGTGTAAAGGGGGAATAAGG + Intronic
902280016 1:15367536-15367558 GAGTGTGCTCAAGGAGAAGATGG + Exonic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902779191 1:18693578-18693600 GAGTGAGGACAGGGGGCGGAGGG - Intronic
903019646 1:20385108-20385130 GAGTGTGCAGAGGGAGAGGAAGG - Intergenic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904400457 1:30253481-30253503 GAGTGTGGTCAAGGAGAAGAAGG + Intergenic
904566670 1:31432201-31432223 GAGAGTGGACAGGGTGGAGAGGG + Intronic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905940407 1:41858764-41858786 GAATGTCTACAGGGGTAAGAGGG + Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906330733 1:44881951-44881973 GAATCTGTACTAGGGGAAGAAGG + Intronic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
906976633 1:50581435-50581457 TAGTGTGTACATGGAGTAGAGGG - Intronic
907385516 1:54122914-54122936 GAGTGTGTGCAGGGGGAACCTGG + Intergenic
907497234 1:54853210-54853232 GAGGGGGTGCAGGGAGAAGAGGG + Intronic
907924692 1:58944488-58944510 GTGTGTGTACTGGGGCAAGGGGG - Intergenic
909662938 1:78104165-78104187 TGGTGTGTAGAGGGGGGAGAGGG + Intronic
910355977 1:86355673-86355695 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
910705168 1:90121987-90122009 GTGTGTGTATAGTGGGATGATGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911437373 1:97878339-97878361 GAGTGTGTAAAGTGGAAAGAGGG - Intronic
912485603 1:110025191-110025213 GTATGTGCACTGGGGGAAGAGGG - Intergenic
912503408 1:110137470-110137492 CAGTTTGTACATGGGGAAAAGGG - Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913134766 1:115877692-115877714 GCGTGTGCACTGGGGGAAGTGGG + Intergenic
913714168 1:121517201-121517223 AAGTGTATAAAGGGGGAATAAGG - Intergenic
914949209 1:152097220-152097242 GTGAGGGTACAGGGAGAAGATGG - Intergenic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
916619912 1:166486032-166486054 GTGGGTGCTCAGGGGGAAGAGGG - Intergenic
917149229 1:171927389-171927411 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
917271019 1:173274517-173274539 GTGTGTACACAGTGGGAAGAGGG - Intergenic
918122151 1:181549608-181549630 GACTGTCTAAAGGGGGATGATGG + Intronic
919543428 1:198880278-198880300 AAGTGAGTAGAGGGAGAAGAAGG + Intergenic
919806163 1:201382169-201382191 GTGTGTGCACACGGGGACGATGG + Intronic
920988079 1:210909308-210909330 GAGTGTGTAAAGGAGGGAGAAGG - Intronic
921425612 1:214997959-214997981 GAGAGAGTCCAGGGGGAAAAGGG - Intergenic
921594929 1:217044336-217044358 GAGTGTGTACAGATGGCAGGAGG - Intronic
922207148 1:223458042-223458064 GAGTGTGGAGAGTGGGAGGAGGG - Intergenic
922503388 1:226112540-226112562 GACTGTGTAGAGTTGGAAGAGGG - Intergenic
923246904 1:232141069-232141091 GGCTGTGGAGAGGGGGAAGAGGG + Intergenic
924786943 1:247207662-247207684 GACTGTTTATAGGGGGAAAATGG - Intergenic
924795162 1:247287613-247287635 GAGGGTTTGAAGGGGGAAGAGGG - Intergenic
1063127623 10:3149671-3149693 GAGTGTGTTCAGGCTGGAGAAGG + Exonic
1063957586 10:11281053-11281075 GAGTGAGGACACGGAGAAGAGGG - Intronic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1065045855 10:21747185-21747207 GAGTGTGGACAGTTGGCAGAGGG + Intergenic
1065425694 10:25600963-25600985 GGGTGTTTACAGGGAGAAAAAGG - Exonic
1065788144 10:29235477-29235499 GAGTGTGGATAGGAGGCAGAAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1068896528 10:62209604-62209626 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1070780693 10:79135945-79135967 GATTGTGTACAGGGCGATAAAGG - Intronic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1071492280 10:86144018-86144040 CAGTGAGTACTAGGGGAAGAAGG - Intronic
1073098436 10:100994777-100994799 GAGAGGGTACAGGAGGGAGATGG - Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075179346 10:120196118-120196140 GTGTGTGCACAGGGTGATGATGG + Intergenic
1075791172 10:125085369-125085391 GCGTGTGTACAGGAAGGAGACGG - Intronic
1076374122 10:129972408-129972430 GCGTTTGTACTGGGGGAAGACGG + Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1077234166 11:1471977-1471999 CCTTGTGTACAGGGGCAAGAGGG - Intronic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077679252 11:4223958-4223980 GAGTTTGTACAGGGGTCAGGCGG + Intergenic
1080462857 11:32471027-32471049 GATTCTGGACAGTGGGAAGATGG - Intergenic
1080939115 11:36894832-36894854 TAGTGTGTAAAGGGGGAAAAAGG + Intergenic
1081060382 11:38467612-38467634 GAGTGTGGAGAGTGGGAGGAGGG + Intergenic
1081343471 11:41955720-41955742 GAGAATGGACAGGGGTAAGACGG + Intergenic
1083129311 11:60609133-60609155 GAGTGGGTACTGGGGAAAAAGGG - Intergenic
1083147701 11:60771350-60771372 GAGTGTGAACAGGGGGACCCAGG + Intronic
1084536598 11:69761023-69761045 GTGTGTGTACTGGGGGAACAGGG - Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1085331472 11:75655486-75655508 GAGTGTGTGCAGGGAGCAGTGGG + Intronic
1088184099 11:107144237-107144259 GAGACTGTAGAGGGGGAGGAAGG - Intergenic
1088725918 11:112634574-112634596 GAGCCTGGACAGGGAGAAGAGGG + Intergenic
1089038885 11:115426699-115426721 GAGGGGGTAAAGGGGGAAGCAGG - Intronic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1089199411 11:116714792-116714814 GAGTGTGGAGAGGGGGAAAGGGG + Intergenic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1090451575 11:126810955-126810977 GAGTGTGTGCAGGGAGGAGGTGG + Intronic
1090494464 11:127196450-127196472 GAGTGAGTACACGGAGATGACGG - Intergenic
1091094083 11:132802214-132802236 GACTGTGTGCTGGGGGAAGGAGG - Intronic
1091182947 11:133623427-133623449 GACTGTGTGCAATGGGAAGATGG + Intergenic
1091887455 12:4027074-4027096 AAGTGTGTGCAGGAGAAAGAAGG - Intergenic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1092796949 12:12121133-12121155 GAGTCTGTACAGGGAGAGGGTGG + Exonic
1093816369 12:23553512-23553534 TGGTGTGTACATGTGGAAGAAGG + Intronic
1093853735 12:24072552-24072574 AAGTGTGTCCTGGGGGATGACGG + Intergenic
1094136359 12:27131051-27131073 GAGAGAGTACAGGAGGAAAAAGG + Intergenic
1094185977 12:27643116-27643138 GAGAGAGTACAGGAGGAAAAAGG + Intronic
1094493827 12:30977310-30977332 GAGTGTGGGCAGGGGGGATACGG - Intronic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1095801317 12:46272011-46272033 GGGTGAGTACAGGGTGAAGCTGG - Intergenic
1096591520 12:52663067-52663089 GGGTGGTTACAGGGGCAAGATGG + Intergenic
1096896106 12:54821822-54821844 GAGTGGGCACAGGGAGAGGAGGG + Intergenic
1097472673 12:60014675-60014697 GAGTGTGCACTGGGGAGAGATGG + Intergenic
1099449722 12:82794334-82794356 GAGTTGGTAGATGGGGAAGAGGG - Intronic
1099833264 12:87873209-87873231 GAGTCTGTAAAAGTGGAAGAGGG - Intergenic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100871559 12:98915245-98915267 GAAGATGTACAGGGAGAAGATGG + Intronic
1101692468 12:107094250-107094272 GAGTATGTACAAGGGGGAGGAGG - Intergenic
1102119589 12:110429809-110429831 GTGTGGGCACAGGTGGAAGATGG + Intergenic
1102645478 12:114400924-114400946 GAGTGTGTGAAGGGGGAGGGTGG - Intronic
1103237684 12:119386979-119387001 GAGAGAGTTGAGGGGGAAGAGGG - Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1105450422 13:20494475-20494497 GTGTGTGTTCAGTGGAAAGATGG - Intronic
1105746030 13:23377659-23377681 GAGTGGGTACCGGGGAAGGAAGG - Intronic
1105812177 13:24005471-24005493 GAGTGTATGCAGGGAGAAAATGG + Intronic
1105928033 13:25025455-25025477 GAGTGTATGCAGGGAGAAAATGG + Intergenic
1106231290 13:27823227-27823249 AAGTGTGTGCAGGGCGAAGGCGG - Intergenic
1107792887 13:44019850-44019872 GAGGGTGTGGAGGGGAAAGATGG + Intergenic
1109561247 13:64052900-64052922 CAGTTTGTACAGGGAGAAGGAGG + Intergenic
1109658822 13:65431421-65431443 GTGTGTGTACTGGGGGCAGAGGG + Intergenic
1110500844 13:76226112-76226134 GTGTGTGCACAGTGGGAACAAGG - Intergenic
1110913530 13:80992876-80992898 GAGGATGGAAAGGGGGAAGAGGG + Intergenic
1111414854 13:87926822-87926844 GAGGGTGTGGAGTGGGAAGAGGG + Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112729739 13:102347500-102347522 GAGTTTGTAAAGGTGGAAGGAGG + Intronic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114656682 14:24319959-24319981 GAGTGTGGACATGGGGAGGAGGG - Intronic
1114673721 14:24428229-24428251 GAGGGTGGGGAGGGGGAAGAAGG - Intronic
1114811164 14:25901305-25901327 GTGTGTGTATAGGGGGGAGATGG - Intergenic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1116927158 14:50651365-50651387 GGGTATTTACAGGGGGAGGAAGG + Intronic
1117547508 14:56805309-56805331 GAGGGTGGGCATGGGGAAGAGGG + Intronic
1118550022 14:66939997-66940019 CAGTCTGTACAGGGAGAAGGGGG + Intronic
1119776401 14:77251807-77251829 GAGGGTGGACAGGGAAAAGATGG - Exonic
1119931722 14:78553998-78554020 GAGTGTGTGGAGGGAGATGAAGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1122848654 14:104514636-104514658 GAGTGTGGTGAGGTGGAAGATGG + Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125717576 15:41827931-41827953 GTGTGTGTCCAGGGGCAGGACGG + Intergenic
1125896508 15:43307290-43307312 GAGTTTGAAGAGGGGGCAGAAGG - Intergenic
1129438703 15:75563076-75563098 GAGTGTGGAGAGTGGGAGGAGGG - Intronic
1129521132 15:76186928-76186950 TAGTGTGTACAAGGGCCAGAGGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130286275 15:82557692-82557714 GTGTGTGTCCAAGGGGAAGGAGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1133177385 16:4025549-4025571 GAGTGTGTGCAAGGTGGAGAAGG + Intronic
1133978768 16:10618699-10618721 GGCTGTGAACTGGGGGAAGAAGG + Intergenic
1135180079 16:20265279-20265301 GAGGGTGGAGAGGGGGAGGAGGG - Intergenic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136464910 16:30436038-30436060 AAGTGTGTACAGGGACAGGATGG - Intergenic
1137906111 16:52323611-52323633 GATAGTGTTCAGTGGGAAGAAGG - Intergenic
1138366351 16:56480970-56480992 GAGTGTGGGCAGGGGCCAGATGG + Intronic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139549264 16:67664458-67664480 GAGTGTGTCCAGGAAGCAGATGG - Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140867250 16:79074063-79074085 GAGTGTATACAGGCTGAGGATGG + Intronic
1141030234 16:80581299-80581321 CATTGAGTACAGGGAGAAGAAGG + Intergenic
1141851656 16:86650246-86650268 GAGTGTGTTCTGGGGGATGAAGG + Intergenic
1142906522 17:3046486-3046508 GACTGTGTATATGAGGAAGAAGG - Intergenic
1142950946 17:3479625-3479647 GAGTCGGTGCAGGGGGAAGGTGG - Intronic
1143447528 17:7018212-7018234 GAGTTCCTACAGAGGGAAGATGG - Intergenic
1143642055 17:8204807-8204829 GTGTATGTATAGGGGAAAGAAGG - Exonic
1144464785 17:15488615-15488637 GAGTTTCTACAGGTGGAGGAGGG - Intronic
1145301709 17:21645571-21645593 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145328017 17:21848132-21848154 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145348601 17:22057753-22057775 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1145694822 17:26779516-26779538 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1145940617 17:28741606-28741628 GAGTGTGGACAGGGGCCAGCTGG - Intronic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1146755237 17:35425431-35425453 TAGTGGTTACTGGGGGAAGATGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147392946 17:40121731-40121753 GAGGGTCTGGAGGGGGAAGAAGG - Intergenic
1147871446 17:43590422-43590444 GAGTCTGTACTGGGGGTAGGGGG - Intergenic
1148679552 17:49465894-49465916 GAGTGTGGAAAGGGGGTAAAAGG - Intronic
1148735798 17:49864267-49864289 GAGTGGGGTCAGGGAGAAGAAGG + Intergenic
1149643247 17:58218901-58218923 GAGGGTGTACTGGGGGCACAGGG + Intronic
1149661370 17:58335767-58335789 ATGTGAGTACAGGTGGAAGAGGG + Intergenic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151264400 17:72943112-72943134 GAGTGTCTTGAGGTGGAAGAAGG + Intronic
1151280272 17:73068819-73068841 GCGTGTGCACAGGGGGAGGCTGG - Intronic
1151290634 17:73147390-73147412 GGGTGTGTACAGGGTGCATATGG - Intergenic
1203192637 17_KI270729v1_random:204353-204375 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1203202004 17_KI270730v1_random:3788-3810 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1153860352 18:9197454-9197476 GACTGTGTGAAGGGGGAAAAAGG - Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1154262752 18:12851749-12851771 GAGTTACTAGAGGGGGAAGAAGG - Intronic
1154308049 18:13244689-13244711 GGGTGTGTCTTGGGGGAAGAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155657249 18:28206609-28206631 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1156023187 18:32622534-32622556 GAGTGTGTTCATGGGCAAGAGGG - Intergenic
1157279364 18:46335570-46335592 GAGTGGGGAGAGGGGGAGGAGGG - Intronic
1157620918 18:49017120-49017142 GTGTGTGTTCAGGGAGGAGAGGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1159552775 18:69913165-69913187 GGGTGTGGAGACGGGGAAGATGG - Intronic
1159867166 18:73719834-73719856 GAGTTGGTGCAGGGGGAAGAAGG - Intergenic
1160216318 18:76935633-76935655 GAGCTTGCACAGAGGGAAGACGG - Intronic
1161443746 19:4306448-4306470 GAGAGTGTACAGGTGGATGGAGG - Intronic
1161684817 19:5697520-5697542 GAGGGAGGAGAGGGGGAAGAGGG + Intronic
1163203203 19:15782822-15782844 GAGGGTGAACAGGGTGATGATGG + Intergenic
1163841502 19:19613708-19613730 GAGTTGGGAAAGGGGGAAGATGG - Intronic
1164823495 19:31267536-31267558 GAGTGGGGGCAGGGGAAAGAAGG - Intergenic
1164962777 19:32449740-32449762 TAGTGTGTACAGTGAGAGGAAGG - Intronic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1166364008 19:42269464-42269486 GAGGGGGTACAGGGGGAAAGGGG + Intronic
1166800786 19:45455858-45455880 GAGTGTCTGCAGGAGGGAGAGGG + Intronic
1166982287 19:46638591-46638613 GAGTGTGTACTGCCGGGAGACGG - Intergenic
1168640542 19:58028801-58028823 GATGTTGTACAGGTGGAAGATGG + Intergenic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925059269 2:878574-878596 GTGTGTGTGTAGGGGCAAGAGGG - Intergenic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925612218 2:5711181-5711203 GGGTGGGGACAGGGGAAAGAGGG + Intergenic
925827563 2:7864352-7864374 GAGTGAGTACAGGGTCAGGAAGG + Intergenic
926854770 2:17242939-17242961 GAGTGGGGAAAGTGGGAAGAAGG - Intergenic
927399904 2:22698711-22698733 GAGAGTGGATGGGGGGAAGATGG - Intergenic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929232154 2:39570852-39570874 GTGTGTGTAAAGGGTGTAGAAGG + Intergenic
930018187 2:46985031-46985053 GAGTGCAGACAGGGGGAAGCAGG - Intronic
930221515 2:48751083-48751105 GAGTATGTGGATGGGGAAGATGG + Intronic
931069062 2:58623827-58623849 GAAGGTCTACATGGGGAAGAAGG - Intergenic
931251867 2:60538777-60538799 GTGTGTGTAATGGGGAAAGAGGG + Intronic
931944664 2:67292298-67292320 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
932330817 2:70897451-70897473 GAGGGTGTACTGGGGGATGTAGG - Intergenic
932429231 2:71664084-71664106 GTGTGTGTGTAGGGGGAAGGGGG - Intronic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
933192331 2:79348840-79348862 GAAAGGGTACAGGGGGATGAGGG - Intronic
933236491 2:79870443-79870465 GAGAGAGAACAGGGGGAAAAGGG + Intronic
933651963 2:84856811-84856833 TAGTGTGTAACGGGAGAAGATGG - Intronic
934521517 2:95023030-95023052 GTGTGTGTTCAGGGGGAGGGAGG - Intergenic
934844449 2:97653603-97653625 AAATGTATACATGGGGAAGAAGG - Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
936605254 2:113945785-113945807 GAGGGTGGAGAGTGGGAAGAGGG - Intronic
937639606 2:124196643-124196665 GACTGTTTACAGTGGGAAGTGGG - Intronic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
939919996 2:148098505-148098527 GAATGTGTACTGAGAGAAGAGGG + Intronic
940120990 2:150265492-150265514 AAGCATGTAAAGGGGGAAGAGGG + Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940697095 2:156993415-156993437 GAGTGTGTAGAGTGAGAAGAAGG + Intergenic
941483511 2:166048345-166048367 GAGTGTGCAAGGTGGGAAGAGGG - Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
943733709 2:191330736-191330758 GAGTCTGTGGAGGAGGAAGATGG + Intronic
943758410 2:191583221-191583243 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
945988100 2:216371178-216371200 GTGTGTGTACCGGGGTGAGAGGG + Exonic
946172995 2:217906310-217906332 GAGTGTGGATGGGGAGAAGAAGG - Intronic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
947544693 2:231002554-231002576 GAGTTTGGAGAGGGGGAAGATGG + Intronic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948315739 2:237027075-237027097 CAGTGTGTCCAGGGACAAGAAGG + Intergenic
1169195501 20:3680333-3680355 GACTGGGTACCGGGGGAAGGAGG - Intronic
1169732416 20:8800953-8800975 GAGTGTGTACATGTGGCAGCAGG - Intronic
1170161657 20:13319729-13319751 GTGTGTGTGCAGGGGGGAGGGGG - Intergenic
1171518287 20:25756954-25756976 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1171558570 20:26099252-26099274 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1172037643 20:32021006-32021028 GGGTGGGTACAGGGGGAGGGTGG - Intronic
1172572946 20:35984524-35984546 GAGAGAATTCAGGGGGAAGATGG + Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1172969999 20:38866283-38866305 GTGTCTGTGCAGCGGGAAGAAGG + Intronic
1173252138 20:41369507-41369529 GAGTGTGGTCAGGGGAGAGAGGG + Intergenic
1173751801 20:45482274-45482296 GAGTATGGAGAGGGGGAGGATGG - Intergenic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174114135 20:48215332-48215354 GAGTGTGTACAGGTGGGACAGGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1174834373 20:53842131-53842153 GAGTGGGTACCGGGGGATTAGGG + Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1176652447 21:9563368-9563390 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177272192 21:18864105-18864127 GAGGGTGTAGGGTGGGAAGAGGG - Intergenic
1177319146 21:19497630-19497652 GAGTGTGTGCTGGGCGAGGATGG - Intergenic
1177570610 21:22881407-22881429 CAGTTTGTACTGGGGGAAAAAGG - Intergenic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1179097644 21:38329819-38329841 GAGAGAGTACAGGGAGAAGAAGG - Intergenic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179633094 21:42690795-42690817 GCGTGGGTACAGGGGTAAGTTGG - Intronic
1179673940 21:42969078-42969100 GGGTGTGTGCAGGGGGCAGTGGG + Intergenic
1181271938 22:21664195-21664217 GAGTGGGGACTGGGAGAAGAGGG + Intronic
1181406727 22:22690224-22690246 GTGAGTGGACAGGGGGAAGCTGG + Intergenic
1182572586 22:31249821-31249843 GTGTCTGGACAGGGGGAAGGGGG + Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183501132 22:38180101-38180123 GTGTGTGTGCTGGGGGAAGTAGG - Intronic
1183705704 22:39473867-39473889 GTGTGTGGGCAGGGGGCAGATGG + Intronic
1184137244 22:42556471-42556493 GAGAATGAATAGGGGGAAGAAGG - Intronic
1184523526 22:45008916-45008938 GAGTGTGTGCCGGGGGAGGGGGG + Intronic
1184677130 22:46049894-46049916 TTGTCTGTACAGGGGGATGAAGG - Exonic
1184987318 22:48144691-48144713 GAGTTTGTACCTGGGGAGGAGGG - Intergenic
949710073 3:6862092-6862114 GAGCGTGGACAGGGGAGAGATGG - Intronic
949853078 3:8438465-8438487 AAGTGAGGACATGGGGAAGAAGG + Intergenic
951357273 3:21683242-21683264 GGGTGTGTACAGCAGGAAGCAGG - Intronic
952911693 3:38194594-38194616 GAGTTAGTACTGGGGAAAGATGG + Intronic
952925626 3:38317250-38317272 GAGGGAGGGCAGGGGGAAGATGG - Intronic
954215074 3:49120244-49120266 AAGTGTGTAAAGGAGGAAGGAGG + Intronic
954764114 3:52898275-52898297 GTGTGTGTGCAGGGGGATGTTGG - Intergenic
954788778 3:53115073-53115095 GAGTAAGGACAGGGGGAGGATGG - Intronic
956185361 3:66557233-66557255 GAGTGGGTAGATGGGGAAAAGGG + Intergenic
957578007 3:82034003-82034025 GAGTGTTTAGTGGGAGAAGAGGG + Intergenic
958706385 3:97661971-97661993 CAGTATATACTGGGGGAAGAGGG - Intronic
959006836 3:101029135-101029157 GAGTGTGGAGGGTGGGAAGAGGG - Intergenic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
960204978 3:114886066-114886088 GAGTGGGTAGAGGGAGCAGAAGG - Intronic
960604430 3:119490245-119490267 GAGTGTATACAGGGCTCAGAAGG - Intronic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
961471460 3:127115754-127115776 GAGTGGGGACAGGGGCAAGAAGG + Intergenic
961684275 3:128618500-128618522 GAGATTGTGCAGGGGGAAAATGG - Intergenic
962179686 3:133192754-133192776 GAGTATGCACAGGAGGAAGCGGG + Intronic
962202807 3:133414794-133414816 GAGTGAGTAGAGGGGTAAGCGGG - Intronic
962318865 3:134374931-134374953 GTGTGTGTACCGGGGGAGGTGGG + Intronic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
963323781 3:143838396-143838418 GAGAGTGTTCAGGAGGGAGAGGG + Intronic
964662864 3:159140057-159140079 GGGGGTGAACAGGGGGAACATGG - Intronic
965024071 3:163275847-163275869 GAATGGGGACAGGAGGAAGAAGG + Intergenic
966450161 3:180050034-180050056 GAGGGTGAAGAGGGGGAAGGAGG - Intergenic
966496183 3:180583975-180583997 TGATGTGTACAGGGAGAAGATGG + Intergenic
967276470 3:187780330-187780352 GTGTGTGTGTAGGGGGCAGAAGG - Intergenic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
968446706 4:655762-655784 GTGTGTGTGCAGGGGTCAGAGGG - Intronic
968446715 4:655802-655824 GTGTGTGTGCAGGGGTCAGAGGG - Intronic
969309064 4:6341693-6341715 GGGTCTGTATAGGAGGAAGAAGG + Intronic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
973793190 4:54396880-54396902 GGGTGTACACAAGGGGAAGAAGG + Intergenic
973864194 4:55095344-55095366 GAGTGTGGACATGGGGGAGAAGG - Intronic
974989974 4:69075420-69075442 AAGTGTGTAGAGGGAGAAAAAGG - Intronic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975727847 4:77309302-77309324 GAATGTGGAGAGTGGGAAGAGGG - Intronic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978736979 4:112094611-112094633 AAGTGTTTGCAGGGGGAATAGGG + Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
986001782 5:3635997-3636019 GACTGTGTACATGGGGGAGCAGG + Intergenic
986027264 5:3862961-3862983 AAATGTGTACAGGATGAAGAGGG + Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
989108299 5:37883962-37883984 CAGTTTGTACAGGGCAAAGATGG - Intergenic
989201498 5:38769025-38769047 GAGTGAGTACAGGGGGTAGCCGG - Intergenic
989250446 5:39308238-39308260 GATTGTGTAAAGAGGGGAGAGGG - Exonic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990668178 5:58097109-58097131 GAGCATGTACTGGGAGAAGAGGG + Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991988197 5:72311314-72311336 GTGTGTATACAGGGGGAAGGAGG + Intronic
992185319 5:74238899-74238921 GGGTGTGCAGAGGGGGAAAAGGG + Intergenic
992443459 5:76814455-76814477 GTGTGTGTGGATGGGGAAGAGGG + Intergenic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995686796 5:114780598-114780620 GAGGGTGTACAGGAGAAAGAGGG - Intergenic
995870610 5:116739917-116739939 GTGTGTGTGCCAGGGGAAGAGGG + Intergenic
997758176 5:136420058-136420080 GTGTGTGTGCATGGGGAAGTGGG + Intergenic
997998515 5:138605706-138605728 TAGGGTGTGCAGGGGGAAAAAGG - Intergenic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
999247369 5:150162292-150162314 GAGGGCTTCCAGGGGGAAGAGGG + Intergenic
1000209534 5:159097182-159097204 GTGTGTGTACAGGGTGACAAGGG - Intronic
1000362701 5:160462718-160462740 GAGTTTGTAGAGGGGGAAGCAGG + Intergenic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1003231391 6:4256832-4256854 GAGTTTGAACAGAGGAAAGACGG + Intergenic
1004548835 6:16626856-16626878 GAGAGGACACAGGGGGAAGATGG + Intronic
1006250787 6:32781915-32781937 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1006295324 6:33167577-33167599 GGGTGTGGGCAGGGGGCAGAGGG + Intronic
1006343529 6:33461340-33461362 GAGTGTGTAAATTTGGAAGAGGG - Intergenic
1006938843 6:37738022-37738044 GAGTGAGTACAGGGAGATGAGGG + Intergenic
1007075031 6:39060856-39060878 GAGTGTGTGCATTGGGGAGAAGG + Intronic
1007607646 6:43128195-43128217 GAGTCTGTATTGGGGGAAGGTGG + Intronic
1009485233 6:64213087-64213109 GAGGGTGCAGAGTGGGAAGAGGG + Intronic
1009569948 6:65371771-65371793 GTGTGTGTAATGGGGGAAGTGGG + Intronic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1011325547 6:86147239-86147261 GAGTGTGTAAAGTGGGACCAGGG - Intergenic
1011957102 6:93037155-93037177 CAGAATGTACAGGGGCAAGATGG + Intergenic
1012242772 6:96892810-96892832 GAATGTGTAGAGTGAGAAGAAGG - Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014471995 6:121827537-121827559 GAGTGAGGAGAGGGGGTAGATGG + Intergenic
1015157957 6:130118506-130118528 GAGAGTGGAAAGGTGGAAGACGG - Intronic
1015623914 6:135160188-135160210 GTGTGTGTACAGGATGAAAAGGG - Intergenic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1017875398 6:158520084-158520106 GAGAGTGGCCTGGGGGAAGAGGG - Intergenic
1017928130 6:158928120-158928142 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018108568 6:160513105-160513127 GAGTGGGGAAAGGGGGAATAGGG - Intergenic
1018245187 6:161815763-161815785 GTCTGTGTGTAGGGGGAAGACGG + Intronic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018512242 6:164537576-164537598 GAGAGTGGAGAGTGGGAAGAGGG + Intergenic
1018747440 6:166773250-166773272 GGGTGAGGAGAGGGGGAAGAGGG + Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019194118 6:170271438-170271460 GGGTCTGTACAGGGGACAGAGGG - Intergenic
1019451028 7:1098142-1098164 GAGTGTGCAGAGGGAAAAGACGG + Intronic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1020706631 7:11552158-11552180 GAGGGTGTAAGGTGGGAAGAGGG + Intronic
1020713339 7:11636697-11636719 GAGTGCATTAAGGGGGAAGAAGG - Exonic
1022013446 7:26328936-26328958 AGGTGTGTACAAGGGGAAGGAGG - Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1024178376 7:46863462-46863484 GAGTGTGTGTGGGGGGAAAATGG - Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024690458 7:51796058-51796080 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1025279114 7:57614295-57614317 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1025305617 7:57851205-57851227 CAGAGTGTAAAGGGGGCAGAAGG - Intergenic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1028725887 7:94087590-94087612 GAAAGTGTGCATGGGGAAGAGGG - Intergenic
1029128569 7:98312734-98312756 GAGTCTGTCTATGGGGAAGAGGG + Intronic
1029421146 7:100472435-100472457 GGGAGGGTACAGGGGAAAGACGG + Intronic
1029650921 7:101890830-101890852 GAGTGTGTAAAGTGAGAAGCAGG - Intronic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1031215166 7:118881256-118881278 AAGTGTGTGAAGGGGGAACAAGG + Intergenic
1031946171 7:127843168-127843190 GATTGTGTGTAGGGGGCAGAAGG - Intronic
1032700796 7:134377329-134377351 GAGTGTGTAAATGGGAAAGATGG - Intergenic
1032855605 7:135830992-135831014 GGGTGGGTACAGGGTAAAGAGGG + Intergenic
1033877341 7:145838586-145838608 GAGGGTGTAAGGTGGGAAGAGGG + Intergenic
1034211476 7:149367303-149367325 GGGTGGGGAGAGGGGGAAGAGGG + Intergenic
1034252963 7:149706841-149706863 GAGTGAGTACAGGAGGAACTGGG - Intergenic
1034349892 7:150408712-150408734 GAGTGTGTACAGGAGCCAGGAGG - Intronic
1034445430 7:151111581-151111603 GCGTGTGCACAGGGGGGTGAGGG - Intronic
1034731516 7:153391367-153391389 GAGTGTGTTTAGGGCAAAGAAGG - Intergenic
1034955739 7:155333336-155333358 GAGTGAGAACACGGGGAAGAAGG + Intergenic
1035056692 7:156040644-156040666 GAGGGAGTGCAGGGGGGAGAAGG - Intergenic
1035146927 7:156828260-156828282 GACTGTGCAGAGGGGCAAGAAGG - Intronic
1035299379 7:157887413-157887435 GAGTGGGTACTGGGGGAAGTGGG - Intronic
1035299413 7:157887522-157887544 GAGCGGGTACTGGGGGAAGCGGG - Intronic
1035299461 7:157887666-157887688 GAGCGGGTACTGGGGGAAGTGGG - Intronic
1035299474 7:157887709-157887731 GAGTGGGTACTGGGGGGAGTAGG - Intronic
1035399086 7:158553114-158553136 GTGTGTGTACATGGGGAAGGTGG - Intronic
1036506060 8:9357390-9357412 GAGTGTGGAGAGTGGGAGGAGGG + Intergenic
1036806924 8:11841407-11841429 GGGTGTGTATAGGAGGAAGAGGG + Intergenic
1037338877 8:17820677-17820699 GTGTGTGTAGAGGGGGAGGGAGG - Intergenic
1038201731 8:25419154-25419176 GTGTGTATACAGGTGGCAGATGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039595129 8:38785059-38785081 AAGTGTCTACAGGGGGAAGCAGG - Intronic
1039818986 8:41119567-41119589 GAGTGAGTACATGAGGAAGGGGG - Intergenic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041480363 8:58313480-58313502 AAGCGTGTTCAGTGGGAAGAAGG - Intergenic
1041793448 8:61721973-61721995 GAGTGGGGACAGGAGGAAGGAGG - Intergenic
1042157862 8:65864642-65864664 GAGGGTTTGAAGGGGGAAGAGGG - Intergenic
1044589699 8:93902037-93902059 GAGTGTGTAAAGGGGAATAAAGG + Intronic
1045553157 8:103190756-103190778 GAGTGTCTGCAGGGTGAAGATGG + Intronic
1046405044 8:113762431-113762453 GAGGGTGTAGAGCGGGAGGAGGG + Intergenic
1046925999 8:119789524-119789546 GTATGTGTGCAAGGGGAAGATGG - Intronic
1047953185 8:129952627-129952649 GAGTGTGAACAGGAGAAATATGG + Intronic
1049365242 8:142233901-142233923 GATTCTGTGCAGGGGGAAGCTGG - Intronic
1049706213 8:144044051-144044073 GAGTGAGTGCAGGGGGAAGGTGG - Intronic
1050039679 9:1476088-1476110 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1050306240 9:4308496-4308518 GAGGGTGTTCAGGTGGGAGATGG - Intronic
1050676284 9:8058061-8058083 GTGTGTGTACAGGGAGAGGGAGG - Intergenic
1050776043 9:9261668-9261690 GTGTGTGTTCAGGAGGGAGAGGG + Intronic
1052203620 9:25811540-25811562 GAGTGTTTTCAGGAGGAAGCAGG + Intergenic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1052513167 9:29447471-29447493 GAGTGAGAACAGGAAGAAGAGGG + Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053308535 9:37000975-37000997 GATTGTGTCCTGGGCGAAGAGGG - Intronic
1053458803 9:38252562-38252584 GAGTGTGCAGAGGGGACAGAGGG - Intergenic
1056119081 9:83469480-83469502 GAGAGAGTACAGGGGCAACAGGG + Intronic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1058195572 9:101970891-101970913 GTGTGTGTCCAGGAGGAAAAGGG + Intergenic
1059732772 9:117073407-117073429 GAGGGTGGACAGTAGGAAGAGGG - Intronic
1059994195 9:119893175-119893197 GTGTCTGTCCAGGGGTAAGATGG + Intergenic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1061799396 9:133105752-133105774 GTGTGCGTGAAGGGGGAAGAGGG - Intronic
1203630176 Un_KI270750v1:66909-66931 CAGAGTGTAAAGGGGGCAGAAGG + Intergenic
1185532858 X:835542-835564 GAGTGTGGACGGTGGGAGGAGGG - Intergenic
1185746123 X:2574859-2574881 GTGTGTACACAGGGAGAAGATGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1186809916 X:13178192-13178214 GAGAGTGTAGAAGGGGAAAACGG - Intergenic
1186855467 X:13621946-13621968 GAGTGTGTAAATTGGGATGATGG - Intronic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1187670561 X:21662041-21662063 GAGGGTGTACTGGGGCAAGATGG - Intergenic
1187679235 X:21750077-21750099 GGGTGTGTTCAGGAGAAAGAAGG + Intronic
1188072086 X:25729483-25729505 GAGGGTGGAGAGTGGGAAGAGGG + Intergenic
1189036183 X:37495709-37495731 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1189037691 X:37509251-37509273 GAGTGTGGAGGGTGGGAAGAGGG - Intronic
1191817324 X:65260415-65260437 GAGGGTGTAGGGTGGGAAGAAGG + Intergenic
1192048729 X:67703397-67703419 GTGTGAGCACATGGGGAAGATGG + Intronic
1193075965 X:77356030-77356052 GCATTTGTACATGGGGAAGAAGG - Intergenic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1193792510 X:85832658-85832680 GAGTGTGTAGATTGAGAAGAGGG + Intergenic
1193990385 X:88299747-88299769 GTGAGGGTACAGGGAGAAGATGG + Intergenic
1194851059 X:98869824-98869846 GAGTGTGGAGAGCGGGAGGAGGG - Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1197080801 X:122413004-122413026 TAGTGTTTAGAGGGGGAAGGAGG + Intergenic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1198792340 X:140359101-140359123 GAATGTGGGCTGGGGGAAGAGGG - Intergenic
1199407546 X:147480166-147480188 GAGGGTGGAGAGTGGGAAGAGGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200061739 X:153486820-153486842 GAGTGTGTGCTGGAGGAAGGCGG - Exonic
1200576672 Y:4896451-4896473 GAGGGTGTAGAGTGAGAAGAAGG - Intergenic