ID: 975147993

View in Genome Browser
Species Human (GRCh38)
Location 4:70991497-70991519
Sequence TTGAAAAATACAAATGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 733}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975147993_975147996 27 Left 975147993 4:70991497-70991519 CCTCCCACATTTGTATTTTTCAA 0: 1
1: 0
2: 3
3: 51
4: 733
Right 975147996 4:70991547-70991569 AAGTTTTTGCAGCCAGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975147993 Original CRISPR TTGAAAAATACAAATGTGGG AGG (reversed) Intronic
900573020 1:3368804-3368826 TTGAAAAAGACAAAGATGGGAGG - Intronic
901101409 1:6721843-6721865 CTTATAAATACAGATGTGGGTGG + Intergenic
901308213 1:8249031-8249053 GTTAAAAATATAAATGTTGGGGG + Intergenic
901625539 1:10622659-10622681 TTGTAAGATATAAATGTGGATGG - Intronic
902093356 1:13922236-13922258 TGGAAAAATACAAGAGTTGGGGG - Intergenic
902344311 1:15804792-15804814 TTAAAAAACACAAATGGGGCTGG - Intergenic
903209479 1:21808814-21808836 TTAAAAAATACAAATAGGGTTGG - Intergenic
903578897 1:24356533-24356555 TTAAAAAAGATAAATGTGGCCGG - Intronic
904182662 1:28677657-28677679 TTGAACCATAAAAATGTAGGCGG - Intronic
905112232 1:35604197-35604219 ATGAAAAAAACTAATGTGGCTGG + Intronic
905195555 1:36274465-36274487 TTGAAAAAGAGAAAAGTTGGAGG + Intronic
905333418 1:37225586-37225608 ATCAAAAATACACATGGGGGAGG + Intergenic
906591286 1:47026480-47026502 TTGGAAAATACCAAAGTGCGGGG - Intronic
907629107 1:56062198-56062220 TTTCAAATTACATATGTGGGAGG + Intergenic
908003132 1:59701199-59701221 TTGCAAGATAAAAATGTGTGGGG - Intronic
908578213 1:65484381-65484403 TTTAAAAAAAAAAGTGTGGGAGG - Intronic
910040986 1:82851427-82851449 TTTAAACATACAAATTTGGGTGG + Intergenic
910641132 1:89463504-89463526 TTGAACAACACAAAAGTGAGTGG + Intergenic
910784406 1:90979309-90979331 TTAAAAAATACAAATTTAGCTGG + Intronic
910981958 1:92966881-92966903 TTTAAAAATAAAACTGTGGCTGG + Intergenic
910988191 1:93027002-93027024 TTAAAAAAAAAAAAAGTGGGAGG + Intergenic
911592570 1:99765303-99765325 TTTAAAAATACAGAAGTGGCTGG + Exonic
911699281 1:100932491-100932513 ATGAAAAATAGAAATGTGAGTGG + Intronic
911702386 1:100968498-100968520 TTGAAAAATAAAAACCTTGGTGG + Intronic
912792926 1:112670938-112670960 TTGAAAAATGCAGATGTTGAAGG + Exonic
912864433 1:113244762-113244784 CTGAAAAATACAAATATTTGTGG + Intergenic
913647563 1:120873714-120873736 TTTCAATATACAAATTTGGGGGG - Intergenic
913649182 1:120894295-120894317 TTTAAACATACAAATTTTGGGGG - Intergenic
913720792 1:121592123-121592145 TTGAAAAATAGAAATGAAGTTGG + Intergenic
914077519 1:144369212-144369234 TTTAAACATACAAATTTTGGGGG + Intergenic
914079075 1:144389146-144389168 TTTCAATATACAAATTTGGGGGG + Intergenic
914100104 1:144577356-144577378 TTTCAATATACAAATTTGGGGGG - Intergenic
914101660 1:144597293-144597315 TTTAAACATACAAATTTTGGGGG - Intergenic
914172426 1:145237752-145237774 TTTAAACATACAAATTTTGGGGG + Intergenic
914173979 1:145257693-145257715 TTTCAATATACAAATTTGGGGGG + Intergenic
914297304 1:146340218-146340240 TTTAAACATACAAATTTTGGGGG + Intergenic
914298885 1:146360326-146360348 TTTCAATATACAAATTTGGGGGG + Intergenic
914527069 1:148478755-148478777 TTTAAACATACAAATTTTGGGGG + Intergenic
914528640 1:148498878-148498900 TTTCAATATACAAATTTGGGGGG + Intergenic
914637752 1:149568229-149568251 TTTCAATATACAAATTTGGGGGG - Intergenic
914639327 1:149588380-149588402 TTTAAACATACAAATTTTGGGGG - Intergenic
915388265 1:155517150-155517172 TTGAAAAATAACAAAGTTGGAGG + Intronic
916306612 1:163341924-163341946 TTGAAAAATAAATAAGTGGCCGG - Intronic
916462149 1:165036483-165036505 TCTAAAAAACCAAATGTGGGAGG - Intergenic
916835044 1:168535401-168535423 TTAAAAAAATCAAATGTGTGAGG + Intergenic
916917781 1:169428464-169428486 TTGAAAAATACAAATTTAGGAGG - Intronic
917021300 1:170591067-170591089 TTGAAAAATACACTTTTGTGTGG - Intergenic
917026369 1:170647036-170647058 TTTAAAAATACACATTTGGCTGG + Intergenic
917812260 1:178671060-178671082 TTAAAAAATATAAATGAGGCTGG - Intergenic
918669760 1:187200540-187200562 CTGAAAAATACAAAATTGGCCGG + Intergenic
918742274 1:188147941-188147963 AAGCAAATTACAAATGTGGGTGG - Intergenic
919228126 1:194735563-194735585 TTGAAGAAAACAATGGTGGGGGG - Intergenic
919416666 1:197319165-197319187 TTTAAAAATAGAAGTTTGGGGGG + Intronic
919557903 1:199083889-199083911 TTGAAAATTACAAATTTGGTGGG - Intergenic
919720616 1:200830004-200830026 TTGAAATATAAAAATATAGGGGG + Intronic
920867760 1:209767673-209767695 TTGAAAAAAAAAAAAGAGGGGGG + Intronic
920904391 1:210148048-210148070 TTGAAAAATATAGATTTTGGTGG - Intronic
922158286 1:223057658-223057680 TTTAAAAATAAAATTATGGGAGG - Intergenic
922286263 1:224173297-224173319 TTCAAAAATATTAATGTGGGTGG + Intergenic
922758960 1:228112881-228112903 TTAAAAAACACAATTATGGGAGG - Intergenic
922950120 1:229552106-229552128 TTAAAAAGTAAAAGTGTGGGGGG - Intronic
922950291 1:229553404-229553426 TTTAAAAATGCAAATCTGGCTGG - Intronic
922968201 1:229710240-229710262 GTTAAAAATACAAATTAGGGGGG + Intergenic
923478727 1:234362148-234362170 TTTAATAATAAAAATGTGGTTGG - Intergenic
923906108 1:238387004-238387026 TTTAAAAATGGAAATGTGGCTGG + Intergenic
1062990717 10:1812778-1812800 TTGAAAAATTCACATGTATGTGG + Intergenic
1063181004 10:3600034-3600056 TTGAAATAAACAAGTGTGGGGGG + Intergenic
1063517018 10:6706409-6706431 TTAAAAAAAAAAAATTTGGGGGG - Intergenic
1063850736 10:10187090-10187112 TTCAAAAATAGAAATGTGCCCGG + Intergenic
1064881347 10:20057921-20057943 TTAAAAAAAAAAGATGTGGGGGG + Intronic
1065017780 10:21477583-21477605 TTGAAAACTACAAGTGTAGCCGG + Intergenic
1065030523 10:21581340-21581362 TTTAAAAACACAAATATGGCTGG - Intronic
1065236369 10:23657012-23657034 AAGAAAAATACAAATGTGAGAGG + Intergenic
1065438385 10:25724710-25724732 TTAAAAAAAAAAGATGTGGGGGG - Intergenic
1065850543 10:29784001-29784023 TTGAACAAGACAGATGTTGGGGG + Intergenic
1066024684 10:31343126-31343148 TTCAAAAAGAAAAATGGGGGAGG - Intronic
1066323479 10:34328918-34328940 TTGAAAAATACAACATTTGGTGG + Intronic
1067111434 10:43403990-43404012 TCGAAAAAAAAAAATGTGGAGGG + Intronic
1067288198 10:44922649-44922671 TTGCAAAATGCAACTGTGGGAGG + Intronic
1067395299 10:45910497-45910519 ATGAAAAAGACAAAGGTGGAAGG - Intergenic
1067863621 10:49879621-49879643 ATGAAAAAGACAAAGGTGGAAGG - Intronic
1068799150 10:61119944-61119966 TAGAAAAATCCAAATGTGGTAGG - Intergenic
1069396828 10:67998549-67998571 TTGAAAAAAAAAAAAGGGGGGGG + Intronic
1069431393 10:68338131-68338153 TTGGAAACTACAGATTTGGGTGG + Intronic
1070073450 10:73112052-73112074 TTGAAAAATATAAATAAGGCCGG + Intronic
1070141499 10:73741432-73741454 TAGAAAAAAAAAAAGGTGGGGGG + Intergenic
1070595712 10:77831515-77831537 TTGAAAATGACTAAAGTGGGAGG + Intronic
1070655725 10:78269828-78269850 TTGGAGAACCCAAATGTGGGAGG + Intergenic
1071026339 10:81118401-81118423 CTGAAAAATAAAAATGTAGAAGG - Intergenic
1071200600 10:83217782-83217804 TTTCAATATACGAATGTGGGAGG + Intergenic
1071365020 10:84890680-84890702 GTGAAAAATATAAATGTGCAGGG + Intergenic
1071474282 10:86012208-86012230 TTGATAAATACAAAGATGAGGGG + Intronic
1071540938 10:86483256-86483278 ATGAAAAATACAAAATTGGCTGG + Intronic
1071688901 10:87794463-87794485 TTAAAAAGAACACATGTGGGAGG - Intronic
1071746813 10:88429482-88429504 TTCAAAAAGACAAAGGTGGCTGG + Intronic
1072161710 10:92772987-92773009 TTGAAAAATAAAAATGAGCATGG - Intergenic
1072354228 10:94590287-94590309 TAGACAAATACAAATGTTGTGGG - Intronic
1073810302 10:107145122-107145144 GTGATAAACACCAATGTGGGTGG + Intronic
1073832055 10:107396041-107396063 TTAAAAAATTCAAATGCGAGTGG + Intergenic
1073836270 10:107446900-107446922 TAAAAAAATACATATGTGTGAGG + Intergenic
1074486154 10:113883102-113883124 TTGAAAAAGAAGAAAGTGGGAGG - Intronic
1074577155 10:114681034-114681056 TAAAAAAATAAAGATGTGGGTGG + Intronic
1075065968 10:119289047-119289069 GTTAAAAATACAAGTGTTGGAGG - Intronic
1075442163 10:122488411-122488433 TACAAAAATACAAAGGTGGTGGG + Intronic
1076355927 10:129853153-129853175 TTTAAAAACACAACTGTGGCTGG - Intronic
1077346500 11:2059646-2059668 ATGAAAAAGAAAAATGTGTGTGG - Intergenic
1077655850 11:4018151-4018173 TTAAAAAATACAAAATTGGCTGG + Intronic
1077784145 11:5364458-5364480 TTGAGAATTACAAATATGGCAGG - Intronic
1078583858 11:12562928-12562950 CTTAAAAAGACAAATGTGGAGGG + Intergenic
1078640801 11:13094028-13094050 AAAAAAAATACTAATGTGGGTGG + Intergenic
1078673840 11:13390631-13390653 TTGAAACATACACATGTGGCTGG - Intronic
1079589477 11:22164801-22164823 TTGAAACAGACAAGTTTGGGAGG + Intergenic
1079921904 11:26443058-26443080 TTGAAAAATAAAAACATGGCTGG - Intronic
1080717159 11:34814277-34814299 ATAAAAAATCAAAATGTGGGGGG + Intergenic
1080750707 11:35147609-35147631 TTGAAAAAAAAAAAAGTTGGGGG - Intronic
1081295442 11:41381204-41381226 TTAAAAAACACCAAAGTGGGGGG + Intronic
1081554656 11:44147297-44147319 CTGAAAAACACAAATGAGGTAGG - Intronic
1082645818 11:55723577-55723599 GTGTAAAATACAAATGTGAAAGG - Intergenic
1083164899 11:60877917-60877939 CTCAAAAATACAAATATGAGAGG - Intergenic
1083928796 11:65826963-65826985 TTTAAGAATATAAATGTTGGTGG - Intronic
1084328774 11:68417620-68417642 TTCAAAAATGCAAATCTGGCCGG - Intronic
1084732090 11:71080206-71080228 TTGGAAAATGCATGTGTGGGAGG + Intronic
1084958383 11:72703437-72703459 GTGAGGAATTCAAATGTGGGAGG - Intronic
1084970602 11:72769638-72769660 TTGAAAAATACATTTTTGGTGGG - Intronic
1086182589 11:83971482-83971504 TGTAATAATACAAAGGTGGGAGG + Intronic
1086506432 11:87509095-87509117 TTGAAAAATGCAAAAGAGGCTGG - Intergenic
1086676130 11:89609430-89609452 TTAAAAAACACAAATTTGGCCGG + Intergenic
1086838418 11:91654163-91654185 TTAAAATATACAAATGAGGCTGG - Intergenic
1086843036 11:91712030-91712052 TTTTAACATACAAATTTGGGGGG + Intergenic
1087225038 11:95589920-95589942 TTTAAAATTACATATGTGGCTGG + Intergenic
1087448345 11:98284284-98284306 TTGGAAATTCAAAATGTGGGTGG + Intergenic
1087491813 11:98837570-98837592 ATTAAAAATACATATGTAGGAGG - Intergenic
1087934781 11:104019818-104019840 TTTAAAAATAAAAATGTGTTTGG + Intronic
1087978292 11:104578192-104578214 TTTTAATATACAAATTTGGGTGG - Intergenic
1088549373 11:110995708-110995730 ATGAAAATTACAAATATGTGTGG - Intergenic
1088629854 11:111764341-111764363 TTGAAGAAGACCAATGTGAGGGG - Intronic
1089980074 11:122765012-122765034 TAGAAAAAAAAAAATGTAGGGGG + Intronic
1091876577 12:3939470-3939492 TTAAAAAATACATATGTAAGAGG - Intergenic
1091890578 12:4050789-4050811 TTTAAAATTACACATGTGGCTGG + Intergenic
1092560432 12:9607555-9607577 TTGAAAAAAATAAATGTATGAGG + Intronic
1093040257 12:14370440-14370462 TTGTAAAATAGAATTGTGAGTGG - Intronic
1093764545 12:22947936-22947958 TAAAAAAATATAAATGTGGTTGG + Intergenic
1094749209 12:33386023-33386045 TTTCAAAAAACAAATGTGGACGG - Intronic
1094860682 12:34462644-34462666 TTGAGAATTCCAAATTTGGGTGG + Intergenic
1095188984 12:39234075-39234097 TTTAAAAAAACATATTTGGGAGG + Intergenic
1095325917 12:40892420-40892442 TGGAAAAATTCTAATGTGGCTGG - Intronic
1096432340 12:51557044-51557066 CTAAAAAATACAAAAGTGGCTGG + Intergenic
1097073022 12:56369732-56369754 TTGAAAACTACATGGGTGGGGGG + Intergenic
1097489547 12:60248882-60248904 ATTAAAAATACAAAAGTGGCCGG + Intergenic
1097666565 12:62484037-62484059 TTGAAAATTAAAAAGGTGGTAGG + Intronic
1097992824 12:65854253-65854275 TTGAAAAACATAAATGTGTAAGG - Intronic
1098133499 12:67376582-67376604 ATGACAAAGACAAATGTGGTTGG + Intergenic
1098781067 12:74687092-74687114 TTGAATATGCCAAATGTGGGAGG - Intergenic
1098854132 12:75633214-75633236 TTTAAACATAAAAATTTGGGGGG - Intergenic
1098895232 12:76052154-76052176 TAGAAAAATCCAAAAGGGGGTGG + Intronic
1099122966 12:78715483-78715505 TTGAAAAATATAAATGAGCAAGG + Intergenic
1099211088 12:79789345-79789367 TGGAAATATTAAAATGTGGGAGG - Intronic
1099339449 12:81409934-81409956 TTTCAACATACAAATGTTGGGGG - Intronic
1099519951 12:83648489-83648511 TTAAAAAAAACAAATTTGGCCGG + Intergenic
1100167814 12:91938161-91938183 ATGAAAAATACAAAGATGAGAGG - Intergenic
1100678182 12:96891070-96891092 GTGAAAAATACAGTAGTGGGAGG + Intergenic
1100710122 12:97246947-97246969 TTAAAAAATAAAAAATTGGGAGG + Intergenic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1102353920 12:112216374-112216396 ATGAAAAATACAAAGAAGGGAGG + Intronic
1102590911 12:113956150-113956172 CTGAAATATACAATTTTGGGGGG + Intronic
1102647014 12:114410154-114410176 GTGAAAAATAGAAGTGTGGACGG + Intergenic
1102693031 12:114776508-114776530 TTAAAAAAAAAAAATGGGGGTGG + Intergenic
1104040582 12:125127738-125127760 TGGAAAAACAGAAATGTGGCTGG - Intronic
1104138562 12:125963817-125963839 TTGAAATAGACAAGTGTTGGAGG - Intergenic
1104676198 12:130714115-130714137 TCCAAAAATACAAACGTGGCAGG + Intronic
1104825590 12:131706571-131706593 TTAAAAAATACAAAAGTAGTCGG + Intergenic
1105063007 12:133171304-133171326 TTAAAAAATACAAATCTGGGTGG - Intronic
1105242504 13:18620654-18620676 TTGAAAAAGCCAAGGGTGGGAGG + Intergenic
1105296696 13:19093470-19093492 TTGAAGATTACAAATGGGTGGGG - Intergenic
1105370625 13:19798782-19798804 TTGAAAAATAACAAAGTTGGAGG + Intergenic
1106646388 13:31638749-31638771 TTGAAAAAAATAAATGTAGTTGG - Intergenic
1107150214 13:37102549-37102571 TTAACAAATCCAAATGTTGGGGG - Intergenic
1107509898 13:41073215-41073237 TTTAAAAATAAAACTGTGGCCGG + Intronic
1107595334 13:41957668-41957690 TTGATAATTATAAATTTGGGTGG + Intronic
1107785478 13:43952357-43952379 TTTCAATATACAAATCTGGGGGG + Intergenic
1107980114 13:45727208-45727230 TTCCAACATACAAATTTGGGGGG + Intergenic
1108201814 13:48051529-48051551 TTCAAAAAGACAAAAATGGGCGG - Intergenic
1108440207 13:50445104-50445126 TTCCAAAATAAAAGTGTGGGTGG - Intronic
1110138149 13:72094063-72094085 TTGCAAAATGCAAGTGTGGAAGG - Intergenic
1110199770 13:72834882-72834904 TTTAAAAATAATAATGTGGTAGG - Intronic
1111170929 13:84525469-84525491 GTGAAAAAGACAAAACTGGGTGG - Intergenic
1111478538 13:88788209-88788231 TTGAAATATCCAAAAGTGAGAGG - Intergenic
1111673819 13:91362342-91362364 TTTAGAGATACAAATATGGGGGG - Intergenic
1112809915 13:103206075-103206097 TTAAAAAAAAAAAATGTGGGGGG - Intergenic
1113080284 13:106512379-106512401 TTGAAAAAAAAAAAGGGGGGGGG + Intronic
1113290842 13:108904466-108904488 ATGAAAAATACAAATTTGTAGGG - Intronic
1113570493 13:111351905-111351927 TTATAAAATTAAAATGTGGGAGG + Intergenic
1113592202 13:111508870-111508892 TTTAAAGATAGAGATGTGGGTGG - Intergenic
1114546267 14:23504128-23504150 ATGAAAAATACAAAATTGGCTGG + Intronic
1114886174 14:26854653-26854675 CTGAAAAATACAAATGATGTCGG + Intergenic
1115365549 14:32553082-32553104 AAGAAAGATACAAATGTGAGGGG - Intronic
1115876636 14:37868774-37868796 TTTGAAAATACAAATGTAAGAGG - Intronic
1116043637 14:39716172-39716194 TTTAAAAATAGGAAAGTGGGTGG - Intergenic
1116157737 14:41229626-41229648 TTGAAAAATAAAAATTTAAGTGG - Intergenic
1116299861 14:43164776-43164798 ATGAAAAATACAAAAATTGGCGG - Intergenic
1116427034 14:44803712-44803734 GTGAAAAAGAGAAATGTGGTTGG + Intergenic
1116520151 14:45836606-45836628 TAGCAAAAAAAAAATGTGGGTGG - Intergenic
1116803994 14:49473714-49473736 TTAAATAACACAAATCTGGGTGG + Intergenic
1116815203 14:49577256-49577278 TTAAAAAATAAAACTGTTGGGGG + Exonic
1117394782 14:55298553-55298575 TTGAAAAAAGCAAATTTGGCAGG + Intronic
1117572180 14:57058408-57058430 TTTATACATACAAAGGTGGGAGG - Intergenic
1117677958 14:58173941-58173963 TTTAAAAATACATTTGGGGGTGG + Intronic
1117804427 14:59476101-59476123 TGCAAAAACACAAATGTTGGTGG + Exonic
1117961296 14:61165163-61165185 TTGAAAAAGATAAAAGTTGGAGG - Intergenic
1118233764 14:63979910-63979932 AAGAAAAATAGAAATGAGGGGGG + Intronic
1118656691 14:67958461-67958483 TTGATGAAAACCAATGTGGGTGG - Intronic
1119726642 14:76925465-76925487 TTAAAAAAAAGAAATGGGGGCGG + Intergenic
1120068387 14:80073400-80073422 TTGAAAAAAAAAATTGTGAGTGG - Intergenic
1120436004 14:84483418-84483440 TTGAAAAATTCAACTGAGAGAGG + Intergenic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122269913 14:100564286-100564308 TTGAAAAATTCTATTTTGGGGGG + Intronic
1122285764 14:100651506-100651528 TTGAAAAATACAGTGGTGAGCGG - Intergenic
1122648573 14:103211445-103211467 TTGAAAAAGAACAATGTGGCCGG - Intergenic
1123488794 15:20763939-20763961 TTGAAAAAGCCAAGGGTGGGAGG - Intergenic
1123545293 15:21333026-21333048 TTGAAAAAGCCAAGGGTGGGAGG - Intergenic
1123689880 15:22829417-22829439 TGCAAAAATACTAAGGTGGGGGG - Exonic
1123703518 15:22933608-22933630 TTGAAAAATACAATTGAGGCCGG - Intronic
1124224809 15:27884084-27884106 TTTAAAAATAAAAATGTGCCAGG + Intronic
1124463435 15:29914493-29914515 TTGGAAAATACAAAGATGTGAGG + Intronic
1124898124 15:33796428-33796450 TTCAAAAAGACAAATGGGGCTGG - Intronic
1126055527 15:44726437-44726459 TTCAAAAAAAAAAAAGTGGGGGG + Intergenic
1127499320 15:59541877-59541899 TAGAAAATTACAAGTGTGGCTGG - Intergenic
1127792116 15:62407393-62407415 ATTAAAAATACAGATTTGGGAGG + Intronic
1128354390 15:66914645-66914667 TTGACAACTACAAATATAGGGGG - Intergenic
1129062187 15:72868991-72869013 TTAAAAAATACAATTTGGGGGGG + Intergenic
1129446001 15:75618589-75618611 TTGAAGAAATCAAATGTGGGAGG - Intronic
1130008428 15:80126340-80126362 TTGAAAAATAACAAAGTTGGAGG + Intronic
1130338780 15:82980927-82980949 TTGTAAAATACGCATGTCGGGGG + Intronic
1130347350 15:83060440-83060462 TTGAAAATTATTAATTTGGGGGG - Intronic
1131366679 15:91847401-91847423 TTGAAACATACGAATTTTGGGGG + Intergenic
1131782913 15:95879477-95879499 TTTAAAAATTCAGATGAGGGTGG + Intergenic
1132056417 15:98653203-98653225 TTAAAAAACACAAATGCTGGTGG + Intronic
1132202744 15:99966046-99966068 ATGAAATATACAATTGAGGGAGG - Intergenic
1132202852 15:99966954-99966976 TAGAAAGATACAAATGTTTGTGG + Intergenic
1202953639 15_KI270727v1_random:60297-60319 TTGAAAAAGCCAAGGGTGGGAGG - Intergenic
1132927091 16:2436480-2436502 TTTAGAAGTACAAATGTGGGAGG - Intronic
1133014120 16:2931006-2931028 TTTAAAAATATAAATGTGGCCGG + Intronic
1133083281 16:3340892-3340914 TTGAAAAAAAACAAAGTGGGAGG - Intergenic
1133140668 16:3741506-3741528 TTTAAAAAGAAAAATGTGGCCGG + Intronic
1133486151 16:6220804-6220826 TTAAAAAATACATCTGAGGGTGG - Intronic
1133708076 16:8374641-8374663 TAGAAAAATACGGATTTGGGAGG - Intergenic
1133925079 16:10185682-10185704 TTTTAAAATACAGATGTGGCTGG + Intergenic
1134122004 16:11591146-11591168 TTGAAAAATAACAAAGTTGGAGG + Intronic
1134182644 16:12060243-12060265 ATGTAAAGTACATATGTGGGAGG + Intronic
1134191388 16:12123869-12123891 TTGAACAGTACAGAAGTGGGTGG + Intronic
1134621576 16:15693501-15693523 TTTAAAAAGACTAATGTGGCTGG + Intronic
1136141254 16:28290287-28290309 CTGTAAAATACAAATGGGGTTGG - Intergenic
1137797953 16:51237869-51237891 TTGAAAAATACAAAATTGGTAGG - Intergenic
1137890451 16:52155960-52155982 TTGAAAAAGACCAATGTTGTAGG - Intergenic
1138055346 16:53827215-53827237 TAGAAGAAGAGAAATGTGGGTGG - Intronic
1138057079 16:53846502-53846524 TTTAAAAATATAAAAGTGGCTGG + Intronic
1138117810 16:54374256-54374278 TTGAAAAAAACAGAAGAGGGAGG + Intergenic
1138141363 16:54571399-54571421 TTTAAAAATACAAATTAGGCCGG - Intergenic
1138582178 16:57948841-57948863 TTGAAATATATGGATGTGGGTGG + Intronic
1138819908 16:60246427-60246449 TTAAAAAATACAACTGCGAGAGG + Intergenic
1138826033 16:60321193-60321215 TTGATAAAACCAAATGTGGTTGG + Intergenic
1138843821 16:60540533-60540555 TGGAAAAATAAATATGTGGATGG + Intergenic
1138893013 16:61167926-61167948 ATGAAAAGTAAAAATCTGGGGGG + Intergenic
1139086641 16:63595079-63595101 TGAATAAATAGAAATGTGGGTGG + Intergenic
1140609888 16:76585499-76585521 TTTAAAAGTACAAATGTATGTGG + Intronic
1140721218 16:77774022-77774044 CTGAAAGATAGAAAAGTGGGAGG + Intergenic
1141494518 16:84398104-84398126 TTAAAAAAAACACATGTGGCCGG + Intronic
1141606613 16:85157616-85157638 ATGAAACTTACAAATGTGAGGGG + Intergenic
1143528341 17:7485010-7485032 TTGCAAAATATAACTCTGGGAGG - Intronic
1143880420 17:10025644-10025666 TTGAAAAACACTGCTGTGGGGGG - Intronic
1144387027 17:14757873-14757895 TTGAAAAATAAAAAAATTGGAGG - Intergenic
1144558747 17:16304459-16304481 TTGAAAAGTACAAAGCTGGGTGG + Intronic
1144806286 17:17970358-17970380 ATTTAAAATACAAATGTGGTTGG - Intronic
1145178550 17:20723620-20723642 TTAAAAAAAAAAAAGGTGGGTGG - Intergenic
1146178395 17:30681342-30681364 TTAAAAAATAAAAATGAGGCAGG - Intergenic
1146286709 17:31578902-31578924 TTGAAAAATACAAAGGGGCCAGG + Intergenic
1146434435 17:32830767-32830789 TTAAAAAATACCGATATGGGCGG + Intronic
1146560632 17:33866428-33866450 TTCAAAAAAAAATATGTGGGGGG - Intronic
1147190738 17:38736536-38736558 TTAAAAAACACCAATGTGGCCGG + Intronic
1148983661 17:51601360-51601382 CTGACAAATAGAAATGTGGAAGG - Intergenic
1149718785 17:58821404-58821426 TAGAAAAATACAAAGCTGGCCGG - Intronic
1149920217 17:60650960-60650982 TTTAAAAATAAAAACTTGGGAGG + Intronic
1150980827 17:70139519-70139541 TAAAAAAAAAGAAATGTGGGAGG + Intergenic
1151808254 17:76420222-76420244 TTTAAAAATGCAAATATGGTAGG + Intronic
1151998105 17:77624513-77624535 TTGAAAAATAATAAAATGGGAGG - Intergenic
1152823844 17:82450970-82450992 TTGAAAAAAAGAAACGTGCGGGG + Intergenic
1154446439 18:14439223-14439245 TTGAAAAAGCCAAGGGTGGGAGG - Intergenic
1154959989 18:21298643-21298665 TTGAAAAACACAAATGTATATGG - Intronic
1155090328 18:22503005-22503027 TTGAAAAATATATATGTTGCCGG - Intergenic
1155852592 18:30791295-30791317 TTGAGAAAGAAAAATGTGAGAGG + Intergenic
1155907774 18:31473154-31473176 TTGGAAAAGACAAAGTTGGGTGG - Intronic
1156574002 18:38292051-38292073 TTTAAAAATACAAATGTTCTTGG + Intergenic
1156650698 18:39223339-39223361 TTTAAAAATTCAAAAGTGGGAGG + Intergenic
1157411735 18:47468873-47468895 TTGAAAAATTCCAATTTGGCTGG - Intergenic
1157685218 18:49637901-49637923 TAGAAAAAAACAAATGTGTTAGG - Intergenic
1158300593 18:56047815-56047837 TTGAAAAATATAAACATGGAAGG + Intergenic
1158488873 18:57892445-57892467 ATGTAAAATACAAATGTCTGTGG + Intergenic
1158525602 18:58210003-58210025 TAAAAAAATACAAATTTGGCCGG + Intronic
1158813379 18:61064263-61064285 TTGAAAAATAAAACTGTGATGGG + Intergenic
1160290708 18:77590566-77590588 TTCAAAAATAGATATTTGGGAGG + Intergenic
1160292566 18:77607737-77607759 TTGTACAATTTAAATGTGGGAGG - Intergenic
1161098508 19:2408236-2408258 TTCATAAATATTAATGTGGGGGG + Intronic
1161350953 19:3791344-3791366 TTCAAAAAAAAAAAAGTGGGGGG - Intronic
1162067323 19:8133928-8133950 TTTAAAAAAAAAAATGTGGCTGG + Intronic
1162089900 19:8272457-8272479 TTGATAAAAACAGATGTGGCCGG + Intronic
1162092131 19:8287313-8287335 TTGATAAAAACAGATGTGGCCGG + Intronic
1162845622 19:13390108-13390130 ATAAAAAATAAAAATGTAGGTGG - Intronic
1162980202 19:14234111-14234133 TTAAAAAATAAAAATGAGGGAGG + Intergenic
1164288534 19:23845473-23845495 ATGAAAATTAAAAATGTGTGGGG - Intergenic
1164428098 19:28161706-28161728 TTGAAAAGTACTAATTTTGGGGG + Intergenic
1165531635 19:36407370-36407392 TTGAAAATTAAAAATCTGGCCGG - Intronic
1165662716 19:37595772-37595794 TTGAGAAATTGAAATGTGGCTGG + Intronic
1166742113 19:45120913-45120935 GTCAAAAGTACAAATGTGCGGGG - Intronic
1166826265 19:45611247-45611269 TTGAAAAATACAAAATTAGCCGG + Intronic
1167290335 19:48621239-48621261 ATGAAAAATACAAAAGTAGCTGG - Intronic
1167766281 19:51484895-51484917 TTGAAGAATGGATATGTGGGTGG + Intronic
1167770181 19:51509984-51510006 TTGGAGAATACACATGTTGGTGG - Intergenic
1167778023 19:51574388-51574410 TTGAAACATACAAGTTTAGGTGG + Intronic
1168009315 19:53517852-53517874 TGGAAAGATACAAACGTGTGTGG - Intergenic
1168550105 19:57285705-57285727 CTGAAAAATAAAAAACTGGGAGG - Intronic
925789517 2:7469837-7469859 ATGATAAATATAAAGGTGGGGGG - Intergenic
925803947 2:7630023-7630045 ATGTAAAATAGAAATGGGGGAGG + Intergenic
925932443 2:8719997-8720019 TTTAAAAATACAAATGATGAAGG - Intergenic
925992135 2:9262156-9262178 TTGAAAAATTTAAATGTTGATGG + Intronic
926080681 2:9983858-9983880 TTTAAAAAAAAAAATGTGGCCGG + Intronic
926239800 2:11076704-11076726 TTGAAAAATGCAGATGTTGAAGG - Intergenic
926442609 2:12906056-12906078 TGGAAAAATAGAAAACTGGGAGG + Intergenic
926840522 2:17074776-17074798 TTTCAACATACAAATTTGGGCGG - Intergenic
927209898 2:20632689-20632711 TTGAGAGATAGAAATCTGGGAGG - Intronic
928111815 2:28516738-28516760 ATGAAAGCTACAAATTTGGGTGG + Intronic
928349919 2:30540957-30540979 TTAAAAAAAATAAATGTGGCCGG - Intronic
928669162 2:33582697-33582719 TTAAAAAATAATAATGTTGGGGG + Intergenic
928818387 2:35326880-35326902 CTGAAAAATAATAATGTTGGAGG + Intergenic
929267895 2:39939622-39939644 ATGACAAAGACAAATTTGGGAGG - Intergenic
929349548 2:40932999-40933021 CTCAAAAATACAAATATGGCTGG - Intergenic
929368290 2:41188793-41188815 TTTAAAAATAGTAATGTGGCAGG + Intergenic
929634971 2:43510422-43510444 CTTAAAAATACAAAAGTGTGGGG - Intronic
929715805 2:44308285-44308307 TTGAAAAATAACAAAGTTGGAGG - Intronic
929742150 2:44614013-44614035 TAGATAAATACAAATGTAGAAGG + Intronic
931113051 2:59134195-59134217 ATGAAGAATACCATTGTGGGTGG - Intergenic
931189414 2:59985468-59985490 TTTAAAAATAAAACTGTGAGTGG + Intergenic
931359647 2:61567159-61567181 GTCAAAATTACAAATGTGGCAGG - Intergenic
931613968 2:64136607-64136629 GTTAAAAATACAAATGAGGCTGG + Intronic
931882958 2:66586102-66586124 TAGAAAAATACTGTTGTGGGAGG + Intergenic
931896687 2:66739557-66739579 TTGAAAAATAACAAAGTGAGAGG - Intergenic
932985236 2:76718575-76718597 TTGAAAAATACTTATTTAGGAGG + Intergenic
933417053 2:81999660-81999682 TAGAAAAACAGAAATTTGGGGGG - Intergenic
933710634 2:85323252-85323274 TAAAAAAATACACATGTGGCTGG - Intronic
933797561 2:85932247-85932269 TTAAAAAAGACAAAGGTAGGGGG - Intergenic
933903507 2:86866465-86866487 TGGAAAAATAAAAATGTGGGAGG - Intergenic
933976616 2:87517215-87517237 TGGAAAGACACAAATGTGCGTGG + Intergenic
934930109 2:98415195-98415217 TTTCAACATACAAATTTGGGGGG + Intergenic
934931245 2:98426067-98426089 TTGAAAAATAACAAAGTGAGAGG + Intergenic
935316094 2:101835704-101835726 TTTAAAAATAGCAAAGTGGGAGG - Intronic
935723616 2:106001842-106001864 TTGAAAAAGAAAAATGTTGGGGG - Intergenic
935777007 2:106482500-106482522 TGGAAAAATAAAAAAGTGGGAGG + Intergenic
935859836 2:107317007-107317029 TTGAAAAATAGAACTTTGGGAGG - Intergenic
936119504 2:109729348-109729370 TTAAAAAATACAAAGCTGGCTGG + Intergenic
936157190 2:110055715-110055737 TTGAAACACACAAATGTCTGAGG - Intergenic
936187504 2:110315729-110315751 TTGAAACACACAAATGTCTGAGG + Intergenic
936272923 2:111065057-111065079 TTGAAAAAGAATAAAGTGGGAGG + Intronic
936317203 2:111433589-111433611 TGGAAAGACACAAATGTGCGTGG - Intergenic
936796364 2:116209315-116209337 TTGAAAAATAAAAAATTTGGAGG - Intergenic
936831403 2:116652829-116652851 GTGAAGAATACAAATATAGGAGG + Intergenic
937424898 2:121790564-121790586 GTGCAAAATGAAAATGTGGGGGG + Intergenic
938991536 2:136634808-136634830 TACAAAAATACAAATCTGGCCGG - Intergenic
939140645 2:138350612-138350634 TTAAAAACTACAACTGTGGCTGG + Intergenic
939469570 2:142602481-142602503 CTGAAAAATACAAATGTCTTAGG + Intergenic
940055360 2:149507402-149507424 TTGAAAAACACATTTGTGGGGGG - Intergenic
940406172 2:153305015-153305037 TGGAAAAATATAATTTTGGGGGG + Intergenic
940723170 2:157304267-157304289 TTTAAAATGACAAATATGGGAGG - Intronic
940933241 2:159461589-159461611 TTGAAAAATGCAGATGTTGAAGG - Intronic
940992730 2:160114499-160114521 GTGAAAAATACAAAGCAGGGGGG + Intronic
941166493 2:162088598-162088620 CTGAAAAATATAATTTTGGGTGG + Intergenic
941332619 2:164197383-164197405 TTGAAGAAGACAAATATGGCTGG - Intergenic
941349244 2:164412145-164412167 TTGCAAAATAACAATGAGGGAGG + Intergenic
942155466 2:173122980-173123002 TTGAAAAATACCTAAGTGAGGGG - Intronic
942472857 2:176280564-176280586 TGGAAAGACACAAATGTGTGTGG - Intronic
942891368 2:180992960-180992982 ATGAAATATATAAATGTGGTAGG - Intronic
943068802 2:183117232-183117254 TAAAAAAATACAAATTTGGCTGG - Intergenic
943339600 2:186663718-186663740 ATGAAAAATACCAATGCAGGTGG - Intronic
943560427 2:189454777-189454799 TATAGAAATACAAATCTGGGAGG - Intronic
943867906 2:192952893-192952915 TTAAAAAATAAAAATGTTAGTGG + Intergenic
944651523 2:201835253-201835275 TTGAAACATACAATTGGGGATGG - Intronic
945127699 2:206531096-206531118 TTAAAATATACAAATGTTTGAGG + Intronic
945780918 2:214170997-214171019 TGGATAAATACAAATGGGTGTGG + Intronic
946109882 2:217405460-217405482 TTCAATAATAGAAATGTGGCAGG + Intronic
946367857 2:219261323-219261345 CTGATAAAAACAGATGTGGGAGG - Intronic
946505285 2:220293864-220293886 CTGAAAAATACTAATGCAGGTGG + Intergenic
947064381 2:226205291-226205313 TTGAAAAATTCACATATGTGTGG - Intergenic
947111904 2:226727563-226727585 TTTAAAAATACAAAAGGGGTTGG - Intergenic
947333529 2:229055586-229055608 TTAAAAGATACAAATGTCTGGGG - Intronic
947387187 2:229602926-229602948 TTGAATAAGAACAATGTGGGAGG + Intronic
947648652 2:231765280-231765302 ATAAAAAATAAAAAAGTGGGAGG + Intronic
947766648 2:232642086-232642108 ATGAAAAAGACAAATGAGGCCGG + Intronic
947904088 2:233747147-233747169 ATGAAGAAAACAAATGTAGGAGG + Intronic
948104789 2:235404993-235405015 TTAAAAAATAAAAATGTTTGGGG + Intergenic
948744988 2:240083628-240083650 TTGAAAAATACAAATTGGACAGG + Intergenic
1169127971 20:3144231-3144253 TTGAAAAATAACAAAGTTGGAGG + Intronic
1169153245 20:3306981-3307003 TTCAAAAGTACAAATGTAGAGGG - Intronic
1170831961 20:19850581-19850603 TTGGATAATACAAGTGTAGGTGG - Intergenic
1171192377 20:23167872-23167894 TTTACAAATACAAATGGTGGTGG + Intergenic
1171420935 20:25017255-25017277 TTGAGAAATACAAATCTAGGGGG + Intronic
1172423687 20:34839513-34839535 TTGAAAAAGAACAATGTTGGAGG - Intergenic
1172591951 20:36123950-36123972 TTGTAAAACACAAATTTGGCTGG + Intronic
1172914390 20:38432944-38432966 TGGAAAAAGACAACTGTGGCTGG - Intergenic
1173814018 20:45973393-45973415 TTGAAAGATACAAATTTTGGGGG + Intergenic
1174029815 20:47613989-47614011 TTGAAAGAAACAAAGGTAGGAGG + Intronic
1174209964 20:48870049-48870071 GTGAAAAATATATATGTAGGAGG - Intergenic
1174610345 20:51793200-51793222 TTGAAATGTACAAATGTGGCTGG + Intronic
1174618590 20:51856150-51856172 TTGAAAAAAAAAGGTGTGGGGGG - Intergenic
1174766750 20:53261633-53261655 TTCAAAAGTCCAAATGAGGGGGG - Intronic
1175005463 20:55677625-55677647 TTAAGAAATGCAAAGGTGGGTGG - Intergenic
1176157510 20:63629190-63629212 TTAAAAAATGCAAATGTGTCCGG + Intergenic
1176449542 21:6850622-6850644 TTGAAAAAGCCAAGGGTGGGAGG + Intergenic
1176827712 21:13715646-13715668 TTGAAAAAGCCAAGGGTGGGAGG + Intergenic
1177608224 21:23409358-23409380 ATGAAAAATACAACTGTAGTTGG + Intergenic
1177809783 21:25913957-25913979 TGGAAATATACAAATTTGAGTGG - Intronic
1177873326 21:26600037-26600059 TTGACAAATGCAAAGTTGGGAGG - Intergenic
1177928654 21:27250984-27251006 TTGAAAAATAAAAATGTAACAGG + Intergenic
1178170406 21:30033955-30033977 TGTAAAAAACCAAATGTGGGAGG + Intergenic
1178263352 21:31120198-31120220 TTGAAAATGACAAAGTTGGGTGG + Exonic
1178322206 21:31614311-31614333 TTAAAAAACAAAAATGTAGGAGG - Intergenic
1178332042 21:31706443-31706465 TTGGAAAATACAAACGGGGCCGG + Intronic
1178390599 21:32194877-32194899 TTGCAAATTCCAAAGGTGGGAGG + Intergenic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1180825740 22:18859608-18859630 TTGAAAAAAAAAAAGGGGGGGGG + Intronic
1181212209 22:21295553-21295575 TTGAAAAAAAAAAAAGGGGGGGG + Intergenic
1182410562 22:30181511-30181533 TTTTAAAATGCAAATGTGGGAGG - Intergenic
1182503451 22:30765187-30765209 ATAAAAAATAAAAATGGGGGAGG - Intronic
1183980475 22:41536889-41536911 TTTAAAAAAAAAAAGGTGGGGGG + Intronic
1184441614 22:44520199-44520221 TTGAAAAATTCACTTGGGGGTGG - Intergenic
949314517 3:2737078-2737100 TCGAAAAATAAAAATATGGCTGG - Intronic
949470148 3:4386069-4386091 TTGAAAAATAATAATGTGAGAGG - Intronic
949653375 3:6187588-6187610 TTAAAAAATAAAAATATGGCCGG - Intergenic
949773399 3:7603688-7603710 ATGACAAATACAACTGTAGGAGG - Intronic
949981841 3:9506875-9506897 TTAAAAAATAACAATGAGGGCGG - Intronic
950321306 3:12056765-12056787 TTGGCAAATAGAAGTGTGGGTGG + Intronic
950696934 3:14708464-14708486 TTGAAAAAAAAAAAAGTGGGAGG - Intronic
951073293 3:18358689-18358711 TTGAAAAATAAACATATTGGGGG - Intronic
951114843 3:18847283-18847305 TAGAAAAGTACAAAAGTGGCCGG - Intergenic
951273789 3:20659880-20659902 GGGAAAAATACAAATATGGCAGG + Intergenic
951831353 3:26931532-26931554 TTTAAAAAGAGAAATATGGGAGG - Intergenic
952329580 3:32351768-32351790 TTGAAAAATAAAACTGGGTGGGG + Intronic
952564067 3:34634401-34634423 TTTCAAAATACAAATTTTGGGGG - Intergenic
952950263 3:38518135-38518157 TTAAGAAATAGAGATGTGGGAGG + Intronic
953776581 3:45822652-45822674 TTTAAAAAGACAAATGAGGCCGG + Intergenic
953971379 3:47350574-47350596 TTGAAAAATAACAAAGTTGGAGG - Intergenic
954086648 3:48249829-48249851 TTGAAATATACAATTCTGGCTGG + Intronic
954256249 3:49409096-49409118 TTTAAAACTACAAATATGGGTGG + Intronic
954342131 3:49962629-49962651 TTGATAAAAAGAGATGTGGGGGG + Exonic
954342140 3:49962799-49962821 TTTAAAAATAGAAATTTGGCTGG + Intronic
954944869 3:54413253-54413275 TACAAAGATACAAATGTTGGCGG - Intronic
955048674 3:55387679-55387701 TTGAAAAATCCCACTTTGGGAGG + Intergenic
956616932 3:71181734-71181756 TTAAAGAAAACAAATGTGGCCGG + Intronic
956638706 3:71394007-71394029 TTGACACATACAAATGTCTGCGG + Intronic
956669062 3:71669467-71669489 TTCAAAAATTCAATTGTTGGGGG - Intergenic
957165783 3:76671786-76671808 TTTAAAAATACAAATATGTATGG - Intronic
957371897 3:79305189-79305211 TTAAAAATTACAAAAGTGGCTGG + Intronic
957636059 3:82787387-82787409 TTGAAAAATACATCTGTGCTAGG - Intergenic
957754918 3:84472323-84472345 TAGATAAATACAAATGAGAGTGG + Intergenic
957802995 3:85109433-85109455 TTGAAAGATAGAAAAGTAGGGGG + Intronic
957968392 3:87351524-87351546 TAGAAAAATATAAATGTATGTGG - Intergenic
958032865 3:88134102-88134124 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
958456791 3:94342266-94342288 CTGAAAATAACAAATGAGGGAGG - Intergenic
958487144 3:94727260-94727282 AGGAAAAGTACAAATATGGGTGG - Intergenic
958667872 3:97163096-97163118 TTGAAAAGTAAATATGTGAGGGG - Intronic
958973879 3:100643558-100643580 TTTATACATACAAATGTGGATGG + Exonic
959099074 3:101989996-101990018 TTGAGAAATCCATATGTGTGTGG - Intergenic
959523567 3:107348847-107348869 TTTAAAAAAATAAATTTGGGAGG - Intergenic
959958008 3:112261253-112261275 TTGAAAAATATCAATGTCTGTGG - Intronic
960365467 3:116766284-116766306 TTGAAAAATGCACATTTGGTTGG - Intronic
960607449 3:119521693-119521715 TTTAAAAAAAAAAAAGTGGGCGG + Intronic
960674384 3:120180548-120180570 TTTAAAAAATCAAATGAGGGAGG - Intronic
960694081 3:120378635-120378657 TTAAAAAAAAGAAAGGTGGGAGG - Intergenic
960877130 3:122308294-122308316 CTGAAAAATAAACATGTGGCTGG - Intergenic
960878597 3:122321852-122321874 TAAAAAAATAAAAAAGTGGGTGG - Intergenic
961033542 3:123626762-123626784 TTGAACAACACAAATATGAGGGG + Intronic
961716838 3:128863683-128863705 TAGAATCATACAAATGTGGAAGG - Intergenic
962360315 3:134736535-134736557 TTAAAAAATACAAATTTCAGTGG + Intronic
963041725 3:141075140-141075162 TTGAAAAACACAGCTGTGGGAGG + Intronic
963085299 3:141430361-141430383 TTAAAAACTACAAATGAGGCCGG - Intronic
963179201 3:142336395-142336417 TGAAAAAATAAAAAGGTGGGTGG + Intronic
963218147 3:142774257-142774279 TAGAAAATTACATATGTGTGGGG - Intronic
963677956 3:148337547-148337569 TTGAAAAATGCAAAAATTGGAGG - Intergenic
964092217 3:152891159-152891181 TAGTATAATACAAATGTGGTAGG + Intergenic
964654358 3:159050585-159050607 TTCAAAAACAAAAATGTGGTTGG + Intronic
964857425 3:161161898-161161920 TTGAAAAATCCTTTTGTGGGCGG - Intronic
964920956 3:161894920-161894942 ATGAAAAATGCTAGTGTGGGAGG + Intergenic
965246976 3:166285237-166285259 TGGAATAATACAAATTGGGGTGG - Intergenic
965333660 3:167408603-167408625 GTTAAAAATGCAAACGTGGGAGG - Intergenic
966173729 3:177112652-177112674 TTGAAAAGTAGAAATTTGGCCGG - Intronic
966295594 3:178417984-178418006 CTGACAACAACAAATGTGGGTGG - Intergenic
966496087 3:180582495-180582517 TTGACAAATACAAACATGGTAGG - Intergenic
966709173 3:182952575-182952597 TTGAGAAATACTATAGTGGGTGG - Intronic
966952603 3:184836003-184836025 TTGAAAAATCCAAACTTGGCTGG - Intronic
967211165 3:187170654-187170676 TTAAAAAATCCAAATCTGGCTGG - Intronic
967281328 3:187826856-187826878 CTGAAAAATTCATATGTGGAAGG + Intergenic
967357205 3:188585303-188585325 TAGAAAAATACAAAGGGGAGAGG - Intronic
967470253 3:189852665-189852687 TTCAGAAATACAAAGGTGGTGGG - Intronic
967655538 3:192043850-192043872 TTTAAAATGACATATGTGGGAGG + Intergenic
969979434 4:11139471-11139493 TTGAAAAATACATATGGTAGAGG + Intergenic
971279240 4:25227867-25227889 CTGAATAATTCAAATGTTGGAGG + Intronic
971374016 4:26041684-26041706 ACGAAAGAAACAAATGTGGGTGG + Intergenic
971554432 4:27995470-27995492 TCAAAAAATACAAATGCTGGAGG - Intergenic
971563857 4:28114995-28115017 TTGTAACATACAAATTTTGGGGG - Intergenic
971770527 4:30889829-30889851 TTCCAATATACAAATTTGGGAGG + Intronic
971778359 4:30997449-30997471 TTAGAAAATATAAATGTGGATGG + Intronic
972048126 4:34694598-34694620 TTGAGAAATAAATATGTGAGGGG - Intergenic
972337574 4:38121255-38121277 TTGACAAAGACAAAGGTGGCTGG + Intronic
972680133 4:41298375-41298397 TTGAAAAATCCCAGTATGGGAGG - Intergenic
972797057 4:42431766-42431788 TTTAAAAAGAGAAATGTGAGAGG - Intronic
973255063 4:48102267-48102289 TTAAAAAATACAGCTGGGGGTGG - Intronic
973304553 4:48630811-48630833 TTCAAAAACACAAATGTGAATGG - Intronic
973780232 4:54282091-54282113 TTGAAAAAAAGAAATTTAGGAGG + Intronic
973988960 4:56384775-56384797 TTTAAAATTACTAATGTGGCCGG + Intronic
974515343 4:62900949-62900971 TGGAGAAATACAAATGGAGGGGG - Intergenic
974782188 4:66566906-66566928 TTGAAAAATAAAAGTGTGTCTGG - Intergenic
975147993 4:70991497-70991519 TTGAAAAATACAAATGTGGGAGG - Intronic
975245753 4:72119464-72119486 TTGAAAAATCTAAATGTAGCTGG + Intronic
975324068 4:73040305-73040327 TTGAAAATTTTAAATGTGGCTGG - Intergenic
975939685 4:79627919-79627941 TTAAAAAATACACATGTGCCAGG + Intergenic
976097145 4:81520433-81520455 TTAAAAATTAGAAATGGGGGAGG - Intronic
976404749 4:84650578-84650600 ATTTTAAATACAAATGTGGGGGG - Exonic
976946248 4:90772083-90772105 TTGAATAACACAAATGTTAGTGG - Intronic
977235089 4:94498774-94498796 TTCCAAAACACAAATGTGAGAGG - Intronic
977616132 4:99089011-99089033 TTGCAAATTACAGATGTGGACGG + Intergenic
978217741 4:106226272-106226294 TAGAAAAATAAAATTTTGGGAGG + Intronic
978427024 4:108593720-108593742 TCTAAAAATACAAAAGTTGGAGG - Intergenic
978576026 4:110190799-110190821 TTGAAAAAAAAAAAAGTGGCCGG - Intronic
979271522 4:118767927-118767949 TTAAAAAACTCAAATGTAGGGGG - Intronic
979335638 4:119458014-119458036 CTGGAGAATACAAATCTGGGAGG - Intergenic
979872713 4:125845557-125845579 TGGAAACATACACATGTGGGTGG + Intergenic
980231746 4:130054182-130054204 TTGAAAAAAACATCTGTGGAAGG - Intergenic
980585596 4:134810659-134810681 TTCAAAAGTATAAATGTGGCTGG - Intergenic
981196392 4:141925821-141925843 TAAAAAAGTACAAATGTGGCCGG - Intergenic
981550162 4:145935968-145935990 TTTAAAAAAAAAAATGTTGGCGG - Intronic
981719502 4:147787321-147787343 TTGAAACACACAGATGAGGGAGG + Intronic
982515807 4:156347745-156347767 TTTAATAATACAGATGTGGCAGG - Intergenic
982691983 4:158559142-158559164 TTGAAAAATAAAATTCTGGCTGG + Intronic
982882285 4:160734657-160734679 TTTCAATATATAAATGTGGGGGG - Intergenic
983086181 4:163447344-163447366 TAGAAAAAAACAAATGCTGGCGG - Intergenic
983140275 4:164141789-164141811 TTAAAAATTACATATGTTGGGGG + Intronic
983272627 4:165581027-165581049 ATGAGAAATACAAGTGTGGAAGG + Intergenic
983428766 4:167620652-167620674 ATGAAATAAACAAATATGGGGGG + Intergenic
983669513 4:170219368-170219390 TTAAAAAGTCAAAATGTGGGAGG + Intergenic
983715710 4:170778807-170778829 TTTAAAAATGAAAATGTGGCTGG + Intergenic
984075379 4:175171186-175171208 TTAAAAAGTCCAAATGTGGCAGG - Intergenic
984246727 4:177283639-177283661 TTCAAACATAAAAATGTTGGGGG + Intergenic
984851240 4:184154599-184154621 TTTAAAAATAAAATTTTGGGAGG - Intronic
986325794 5:6672893-6672915 GTCTAAAATACACATGTGGGAGG + Intergenic
986390818 5:7286612-7286634 TAAAAAAATATAAATGTGGCCGG + Intergenic
986934528 5:12866675-12866697 CTGAAAAAAAAAAATGTGTGTGG + Intergenic
987091835 5:14514747-14514769 TTGAAAAAAAATAAAGTGGGGGG - Intronic
987291676 5:16514238-16514260 GTTAAAAATAAGAATGTGGGAGG - Intronic
988445680 5:31283695-31283717 TAGGAAAATACAAATATGGGGGG + Intronic
988528133 5:32004090-32004112 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
989250401 5:39307747-39307769 TTCAAAAATACAAATATGTTTGG - Intronic
989329036 5:40234141-40234163 GTTAAAAATACAAAGATGGGAGG - Intergenic
989980457 5:50637587-50637609 TTTAAATATACAAATTTTGGGGG - Intergenic
990314263 5:54569137-54569159 TTGGAAAAAAAAAATGTGGTTGG - Intergenic
990557860 5:56952602-56952624 ATGAAATAGACAGATGTGGGAGG + Intronic
991340111 5:65599790-65599812 TTGAAAAAGAAAAAAGTTGGAGG + Intronic
991612037 5:68459496-68459518 TTGAGAAATAGACATGTAGGTGG - Intergenic
991984475 5:72269894-72269916 ATAAAAAATAAAAATGTGGCCGG + Intronic
993048993 5:82903504-82903526 TTAAACAATAAAAATTTGGGTGG - Intergenic
993274756 5:85843225-85843247 TGAAAAAATACAAATGTTGGTGG - Intergenic
993468333 5:88275179-88275201 TTGTCAAATACAAATGTAAGTGG - Intergenic
993555317 5:89329531-89329553 TTAAAAAAAAAAAAAGTGGGGGG + Intergenic
993566453 5:89481868-89481890 TTTAAAAATACAACTTTGAGTGG - Intergenic
994417603 5:99494032-99494054 TGGAAAAATACAAATGAATGAGG + Intergenic
994462360 5:100081128-100081150 TGGAAAAATACAAATGAATGAGG - Intergenic
994745255 5:103669647-103669669 GGGAAAAATAAAAATGTCGGGGG - Intergenic
995212254 5:109553440-109553462 TTGAAAAATACCAAAGTTGGAGG + Intergenic
995935614 5:117508643-117508665 CTGAAAAATCTAAATGTTGGTGG + Intergenic
996066061 5:119080530-119080552 TTGTATAAGAAAAATGTGGGAGG - Intronic
996136606 5:119850020-119850042 TTGAAAAATAGCAAAGTTGGGGG + Intergenic
996635515 5:125684673-125684695 AAGAAAAATACAAACGTGGAAGG - Intergenic
996997353 5:129714121-129714143 TAGAAAAATACATATCTGGCCGG + Intronic
997180858 5:131827279-131827301 TTGAAAAAAACAATTTTGGCTGG - Intronic
997257086 5:132437533-132437555 TTTAAAAATACAAGTGGAGGGGG - Intronic
997573719 5:134956248-134956270 GAGAAAAATACAAATTTGAGGGG + Intronic
997777614 5:136625115-136625137 TTGAAACATTCATACGTGGGAGG + Intergenic
997930191 5:138066501-138066523 TATAAAAATAAAAATGTGGCCGG + Intergenic
998194877 5:140060009-140060031 AAGAAAAACACAAATTTGGGGGG - Intergenic
998552668 5:143092547-143092569 TTGAGAAAAAAAAAGGTGGGGGG - Intronic
998604296 5:143617682-143617704 GTGAAAACTACAAATATGGCTGG - Intergenic
998724343 5:144992298-144992320 TAGAAAAATACAAATTAGGCTGG - Intergenic
998817853 5:146031844-146031866 TGGAAAAATACACATTTGGCTGG + Intronic
998987739 5:147780761-147780783 GTGAAAATTATAAATGTGGGGGG + Intronic
999334352 5:150702689-150702711 TGGAAAAACACAAATGTACGTGG - Intergenic
999335922 5:150716508-150716530 ATTATAGATACAAATGTGGGAGG + Intronic
999962723 5:156774549-156774571 TTTCAACATACAAATTTGGGGGG + Intergenic
1000169519 5:158688198-158688220 TTAAAAAATACAAATGTAACAGG - Intergenic
1000861065 5:166456676-166456698 TTAAAAAAAAAAAAGGTGGGGGG - Intergenic
1001027216 5:168234245-168234267 ATGAAAAATAGAAATGCTGGGGG - Intronic
1001742370 5:174064682-174064704 ATGAGAAAAACAAAGGTGGGGGG + Intronic
1001812522 5:174640058-174640080 TTAAAAAAAAAAAATGTGGCTGG + Intergenic
1001821153 5:174711297-174711319 TTTAAAAATAAAAGTGTGGCGGG + Intergenic
1001833426 5:174808852-174808874 TTGAAAACTCCAACTGTGTGGGG - Intergenic
1003022828 6:2526446-2526468 ATCAAAATTACAAATGTGGCTGG - Intergenic
1003219606 6:4147049-4147071 TTGAAAACTACAAATGAGAAAGG + Intergenic
1003362176 6:5438250-5438272 CTGAAAAACAAAAATGGGGGGGG - Intronic
1003456766 6:6290441-6290463 TATAAAAATAAAAATGTGGTAGG + Intronic
1003948280 6:11094470-11094492 TTGAAAAAAACAAAAGGGCGTGG + Intronic
1003984545 6:11422311-11422333 TTTAAAAGTACATATGTGGCTGG - Intergenic
1006380549 6:33694843-33694865 TAGAAAAACAGTAATGTGGGGGG - Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007289185 6:40772306-40772328 TTGGAAAACAGAGATGTGGGTGG + Intergenic
1007367501 6:41405342-41405364 TTCCAACATACAAATTTGGGGGG + Intergenic
1007538226 6:42615313-42615335 TTGAAAAATATAGATTTGGTGGG + Intronic
1008140163 6:47822830-47822852 TTGAACAACAGAAGTGTGGGAGG - Intronic
1008296284 6:49782835-49782857 CTGAAAAGTCCAAATGGGGGGGG - Intergenic
1008378146 6:50814426-50814448 TTTAAAAAATGAAATGTGGGTGG - Intergenic
1008584363 6:52935498-52935520 TTAAAAAATAGACATGTGGTCGG + Intergenic
1009053586 6:58308589-58308611 TTACACAATATAAATGTGGGTGG + Intergenic
1009237528 6:61141959-61141981 TTACACAATATAAATGTGGGTGG - Intergenic
1009306553 6:62098038-62098060 TTAAAAATTCCAAATGTGGGGGG - Intronic
1009430254 6:63558164-63558186 TTTAAAAATGCATATGTGGCCGG - Intronic
1009952731 6:70414517-70414539 TTGACTTATACAAATGGGGGGGG - Intronic
1010394156 6:75371525-75371547 TTGAAAAATAACAAAGTTGGAGG + Intronic
1010719396 6:79264818-79264840 TTGAAAAATTCAAATATATGTGG + Intergenic
1012614111 6:101254150-101254172 TTTAGAAATATAAATGAGGGAGG + Intergenic
1012972037 6:105741625-105741647 TTTAAAAATAAAACTGTGTGGGG + Intergenic
1013981528 6:116135414-116135436 TTGTTAAATAAAAAGGTGGGGGG - Intronic
1014133165 6:117857765-117857787 TTTAAAAATAAAAAGGTGTGGGG - Intergenic
1014172262 6:118291819-118291841 TTAAAAAATACTGATGTGGCTGG + Intronic
1014799539 6:125762645-125762667 TTGAAAAATAATAATCTGGCTGG - Intergenic
1015705552 6:136083821-136083843 AAGAAAAATATCAATGTGGGAGG - Intronic
1016176877 6:141089085-141089107 TTAAAAAATTAAAATTTGGGAGG + Intergenic
1016195769 6:141337337-141337359 TTTCAACATACAAATTTGGGGGG - Intergenic
1018197828 6:161370135-161370157 TTTAAAAACACAAGTATGGGAGG + Intronic
1018355959 6:163017239-163017261 GTGATAAATATAAACGTGGGGGG + Intronic
1018601694 6:165550805-165550827 TTGAACATTTCAATTGTGGGAGG - Intronic
1018708074 6:166477206-166477228 TTGTAAAATACACCTGTGGGAGG + Intronic
1019754065 7:2755204-2755226 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1019875257 7:3804862-3804884 TAGAGAAATACAATTGGGGGTGG + Intronic
1020435115 7:8153316-8153338 CTTAAAAATACAAATGCAGGAGG + Intronic
1020482698 7:8681816-8681838 TGGAAAAATATAGATGTGGTAGG - Intronic
1021159938 7:17260221-17260243 TTGAAAACTACATATCTGAGAGG - Intergenic
1021248356 7:18292534-18292556 TTGACAAATACAGAGGCGGGTGG + Intronic
1022016619 7:26355260-26355282 TTGAAAAAGAATAAAGTGGGAGG - Intronic
1022562795 7:31367109-31367131 TTTAAAAATACAAATGAGTATGG + Intergenic
1022704797 7:32792328-32792350 TTGAAAAATCATAATGTGGGAGG + Intergenic
1022910132 7:34892931-34892953 TTGAAAAATCATAATGTGGGAGG + Intergenic
1023059938 7:36317058-36317080 TTGAGAAATACTGATGTGGAGGG + Intergenic
1023062416 7:36341484-36341506 TTTCAAAATAAGAATGTGGGTGG - Intronic
1023084755 7:36559121-36559143 TTGAATAAAGAAAATGTGGGAGG - Intronic
1023195510 7:37634600-37634622 TTGAAAAATTTAACTGTGGGGGG + Intergenic
1023384972 7:39647586-39647608 TTTCAACATACAAATTTGGGGGG - Intronic
1023761578 7:43469249-43469271 TTGAGAAACCCAGATGTGGGTGG - Intronic
1024149321 7:46553831-46553853 GGGAAAGATACAAATGTGCGTGG + Intergenic
1024241138 7:47437557-47437579 TTGAAAAATACAGACTTGTGTGG + Intronic
1024381364 7:48700210-48700232 TTAAAAAATTCAAATGTATGTGG - Intergenic
1024635478 7:51285792-51285814 TTGAAAAATAAGAATGTTGGAGG + Intronic
1024863669 7:53877297-53877319 TTGAAAAATAAAAATTTAGTGGG - Intergenic
1025818391 7:64941463-64941485 TTTTAAAAAACAAATGTGGCTGG + Intergenic
1025909751 7:65818829-65818851 TTTAAAAAAAAAAATGTGGTTGG + Intergenic
1026661192 7:72304220-72304242 TGGAAAAATAAAAATGTGACTGG + Intronic
1026676021 7:72428834-72428856 TTAAAAAATACAAATGCTAGAGG + Intronic
1027055586 7:75047251-75047273 TTTAAAAATACAAAAGCGGCCGG - Intronic
1027247722 7:76378650-76378672 TTTAAAAATTCAAATCTGGCTGG + Intergenic
1027577388 7:79947233-79947255 GTGAGAAATACACATCTGGGGGG - Intergenic
1027663557 7:81016829-81016851 ATGAAAAATAAAAATGCGGCTGG - Intergenic
1027686924 7:81289782-81289804 TCGAAAAATACAAATATTTGAGG - Intergenic
1028125378 7:87106674-87106696 TTAAAACAAACAAAAGTGGGGGG - Intergenic
1028612130 7:92723575-92723597 TAGAAAAATACAAAAGAGTGGGG + Intronic
1029096948 7:98093181-98093203 TTGAAAAATAACAAAGTTGGAGG - Intergenic
1029138235 7:98390430-98390452 TTAAAAAATATAAATATGGCCGG + Intronic
1029807945 7:103016301-103016323 TACAAAAACAGAAATGTGGGGGG + Intronic
1029975763 7:104831669-104831691 TTGAAAAATAAAAATGCAGTGGG + Intronic
1030321526 7:108173388-108173410 TTAAAAAATTAAAATTTGGGAGG + Intronic
1030457699 7:109794966-109794988 TTCAAAGACACAGATGTGGGAGG + Intergenic
1032287945 7:130557508-130557530 TAGAAAAATAAACATGTGGCTGG + Intronic
1032434852 7:131891779-131891801 TTGAAAAATCCAGATGTTGAAGG - Intergenic
1032714042 7:134489065-134489087 TTGAAAAATATATATGGGGCCGG + Intergenic
1032970880 7:137162810-137162832 TAGAAAAATATAAATGTGGCTGG + Intergenic
1032997798 7:137467264-137467286 TTAAAAAATGTAAATGTGGATGG - Intronic
1032998634 7:137477955-137477977 TTTAAAAATACAAATGTAGCTGG - Intronic
1033284832 7:140032325-140032347 TTAAAAAAAACAAATTTTGGAGG - Intronic
1033808970 7:144987655-144987677 ATGAAAAATCCAAATTTTGGGGG + Intergenic
1034237815 7:149586270-149586292 TTGAAAAATACCTAGGTGTGTGG - Intergenic
1034240893 7:149609939-149609961 TTGAAAAATACGTAGGTGTGTGG - Intergenic
1034245909 7:149644144-149644166 TTGAAAAATACATAGATGTGTGG - Intergenic
1034404166 7:150891229-150891251 TTTAAAAATATAACAGTGGGAGG - Intergenic
1035092209 7:156322483-156322505 TTAAAAAATATATATGTGGCCGG - Intergenic
1036944196 8:13079362-13079384 TTTTAAAATACAAATGTGTTCGG - Intergenic
1037396378 8:18448222-18448244 TTGAAAATGACTAATATGGGTGG - Intergenic
1039815443 8:41090483-41090505 TTGAGAAATGGAGATGTGGGAGG - Intergenic
1040455059 8:47589222-47589244 TTTAAAATTACAAATTTGGCCGG + Intronic
1041461212 8:58113701-58113723 TTTCAACATACAAATTTGGGGGG + Intronic
1042334453 8:67615456-67615478 CTGAAAATTACAAATATTGGAGG - Intronic
1042650586 8:71036318-71036340 TTGAAAAATATAGATGTGTAGGG + Intergenic
1042967464 8:74370295-74370317 ATGAAAAACACAAAGGTTGGAGG + Intronic
1043366511 8:79539303-79539325 TTTAAAAATATAAATGTATGGGG + Intergenic
1043413210 8:80021295-80021317 TTAAAAAATACATTTGTGGCTGG - Intronic
1044355600 8:91219228-91219250 TTGAAAAATAAAGATTTGTGTGG + Intronic
1044460079 8:92433929-92433951 ATGAAAGATACTAATGTTGGGGG - Intergenic
1044605524 8:94044090-94044112 TTGAAAACTACTAATGTCTGAGG + Intergenic
1044765357 8:95566394-95566416 TTAAAAAATACAAAAGGGGCCGG - Intergenic
1045286855 8:100799125-100799147 TTGAAACATCCAAATTTTGGTGG + Intergenic
1045522291 8:102913922-102913944 ATGAAAAATACAGAAGAGGGAGG + Intronic
1046209737 8:111054094-111054116 TTGAAAAAGACAAAGTTGGTAGG - Intergenic
1046321492 8:112582707-112582729 TTTTAACATACAAATTTGGGGGG - Intronic
1046388044 8:113529062-113529084 TTGAAATATACAAGAGTGGGGGG + Intergenic
1046697137 8:117354270-117354292 TTGAGAAATAACAATGTAGGAGG + Intergenic
1046717202 8:117580686-117580708 TTGAAAAACACAAAATTGGCTGG - Intergenic
1046857057 8:119044546-119044568 TTGAAAAAAACATAACTGGGCGG + Intronic
1047305396 8:123649200-123649222 TTGAAAAATAGAAAAGAAGGAGG + Intronic
1047520360 8:125591255-125591277 ATGAAAAATACAAAAATGTGTGG + Intergenic
1047606558 8:126480269-126480291 TTTTAACATACAAATTTGGGGGG + Intergenic
1047606762 8:126482318-126482340 TTAAAAAAGACAAAACTGGGGGG + Intergenic
1048146323 8:131847663-131847685 TTGAAAAAAAAAAAAGTTGGAGG + Intergenic
1048912843 8:139152628-139152650 TTAAAAAAAAGAAAGGTGGGGGG + Intergenic
1049914025 9:299013-299035 TTGAAAAATCCAATTTTAGGGGG - Intronic
1050205195 9:3189014-3189036 TTCTAAAATATAAATTTGGGGGG - Intergenic
1051251065 9:15159409-15159431 TAGAAAAATACAAATCAGGCTGG + Intergenic
1051525777 9:18042860-18042882 TTGACAATTACAAACTTGGGAGG - Intergenic
1052007735 9:23369614-23369636 TCAAAAAATTAAAATGTGGGGGG + Intergenic
1052841566 9:33295690-33295712 TTCAAAAATGCAAATACGGGTGG + Intronic
1052873695 9:33535018-33535040 TTGAAAAATTCAAAGGAGGAAGG - Intronic
1053502396 9:38609745-38609767 TTGAAAAATTCAAAGGAGGAAGG + Intergenic
1053728276 9:41026364-41026386 TTGGAAAATGGAAATGTGAGAGG + Intergenic
1054700232 9:68405723-68405745 TTGGAAAATGGAAATGTGAGAGG - Intronic
1054721213 9:68605775-68605797 CTGAAAAATAAAAATGAGGTAGG + Intergenic
1054950201 9:70841917-70841939 TTGGACACTACAAAAGTGGGAGG + Intronic
1055389842 9:75808734-75808756 TTCAAAAAAACTAATTTGGGGGG + Intergenic
1055419159 9:76118960-76118982 TTTAAAAAAACAAATGGGAGGGG - Intronic
1055419872 9:76128034-76128056 ATGAGAAATAGAAATGAGGGGGG + Intronic
1055744212 9:79424923-79424945 TTAAAAAAGACAAAGGTGGCTGG - Intergenic
1055876546 9:80949804-80949826 TTTAAAATTACAAATGTGGCTGG + Intergenic
1055893790 9:81152067-81152089 TTGAAAAAGACAAAGGTGAAGGG + Intergenic
1056887418 9:90456872-90456894 TTGTAAAATAAAAATGTGCAAGG - Intergenic
1056906169 9:90649897-90649919 TTGAAAAAAAAAATTGAGGGAGG + Intergenic
1057153695 9:92819877-92819899 TTGAAAAATTCAAAGGAGGAAGG - Intergenic
1057615814 9:96588768-96588790 TTAAAAACTACAAATTTGGCTGG - Intronic
1057681797 9:97194184-97194206 TTGAAAAATTCAAAGGAGGAAGG + Intergenic
1058742340 9:107956295-107956317 TTTAAAAGGACAAATGTTGGAGG + Intergenic
1059937044 9:119321862-119321884 TTTAAAATTACACATGTGGCTGG + Intronic
1061124454 9:128665466-128665488 TTGAATAAAACAAATGTGTTGGG + Intergenic
1062127909 9:134874648-134874670 TTAAAAAAAACAAATTTGGGAGG - Intergenic
1203519645 Un_GL000213v1:33895-33917 TTGAAAAAGCCAAGGGTGGGAGG - Intergenic
1186094193 X:6082211-6082233 TTGAAAAAGACAAATGAGGTAGG + Intronic
1186116512 X:6309831-6309853 CTGACTAATACAAATGTGGAAGG + Intergenic
1186143807 X:6604581-6604603 TTGCAAAATATACATGTTGGTGG - Intergenic
1186307322 X:8276395-8276417 TTGAAAAAAAAAAATGTGAAAGG + Intergenic
1186678783 X:11849470-11849492 TTGAAAAAGAAAAAAGTTGGGGG + Intergenic
1187573207 X:20526939-20526961 TTGAAGTAGACAAAAGTGGGAGG - Intergenic
1188397207 X:29699887-29699909 TTTAAAAATAGAAATATGGTAGG + Intronic
1188953859 X:36410929-36410951 TTGAAAAATAAAAAAGTTGAAGG - Intergenic
1188957293 X:36448692-36448714 TTAAAAAATACAAAAGTAGCTGG - Intergenic
1189440115 X:41028371-41028393 TTTAAAAATATATATGTGGGCGG + Intergenic
1189961459 X:46328305-46328327 TTTTAAAATGCAAATCTGGGAGG - Intergenic
1190538778 X:51456431-51456453 TTTTAATATGCAAATGTGGGCGG - Intergenic
1190892665 X:54584325-54584347 TTTAAAAATATAAATATGGCCGG - Intergenic
1191797847 X:65041072-65041094 CTGAAAAGAACAAATGTGGCTGG - Intergenic
1192378089 X:70585557-70585579 TTGAAAAATAACAAAGTTGGAGG + Intronic
1192623390 X:72702747-72702769 TTTGAAAAAACAAAGGTGGGGGG + Intronic
1192682157 X:73263316-73263338 TTAAAAAATAGAAAATTGGGAGG - Intergenic
1193785755 X:85757862-85757884 AAAAAAAATACAAAGGTGGGGGG - Intergenic
1193974040 X:88095584-88095606 TTGAAAAATGCAGATGTTGAAGG - Intergenic
1194494631 X:94598595-94598617 TTGAAAAATAATAAAGTTGGAGG + Intergenic
1195374811 X:104216642-104216664 ATTAAAAATACCAATGGGGGAGG + Intergenic
1195584344 X:106547399-106547421 TTGAAAAAGAATAAAGTGGGAGG - Intergenic
1195674063 X:107493700-107493722 TTGAAAATCACAAATGTGAATGG - Intergenic
1195819842 X:108932113-108932135 TTGCAAAATACTAATCTGGCAGG - Intergenic
1196441083 X:115720767-115720789 TTGAAAATAACAAGTGTGTGAGG - Intergenic
1196464217 X:115956984-115957006 TTAAAAAACAAAATTGTGGGAGG + Intergenic
1196494355 X:116306969-116306991 TTGAAAAAAACAAAAGTGGAAGG - Intergenic
1196651699 X:118174449-118174471 TTAAAAAATACAAATCTGTTTGG - Intergenic
1196782187 X:119393590-119393612 TTTAAAATTACAGATGTGGCTGG + Intergenic
1197106081 X:122717824-122717846 TTGAAAAATGCAGAGGTGGATGG + Intergenic
1197303314 X:124807671-124807693 TTAAAAAATCAAAATGTGGGGGG + Intronic
1197452389 X:126636223-126636245 AAGAAAAATACAAATGTTGAGGG - Intergenic
1197482145 X:127000429-127000451 TTCCAAAACAAAAATGTGGGGGG + Intergenic
1197526005 X:127563897-127563919 TTGAACAACACAAATTTGAGTGG - Intergenic
1197939221 X:131771813-131771835 TTAAAAAGAACAAATATGGGTGG - Intergenic
1198135013 X:133740262-133740284 TTGATAAACACAGATGTGTGAGG + Intronic
1198443704 X:136690014-136690036 CTTATAAATAAAAATGTGGGGGG + Intronic
1198949000 X:142048387-142048409 TGGAGAAATACAAGAGTGGGAGG + Intergenic
1198997337 X:142588733-142588755 TTGAAAAACAAAAATAGGGGAGG - Intergenic
1199318877 X:146414845-146414867 TTTAAAAGTCCAAATGTAGGGGG + Intergenic
1199346075 X:146742164-146742186 TTGAAAAAGACCAAAGTTGGGGG - Intergenic
1199742274 X:150746625-150746647 TTTAAAAATCCACATTTGGGAGG - Intronic
1200023398 X:153231432-153231454 TTAAAAAATGTAAATGTGCGTGG - Intergenic
1200146536 X:153929124-153929146 ATGCAAAATACAAAACTGGGCGG - Intronic
1200523117 Y:4236317-4236339 TTGATAAATAAAAGGGTGGGGGG + Intergenic
1201504040 Y:14678046-14678068 TTGAAAAAGACAAGTGAGGTAGG - Intronic