ID: 975155084

View in Genome Browser
Species Human (GRCh38)
Location 4:71062468-71062490
Sequence CTCTAGTTCTTAGGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975155080_975155084 14 Left 975155080 4:71062431-71062453 CCTGCTGAAAAGGCACACATTTT No data
Right 975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975155084 Original CRISPR CTCTAGTTCTTAGGGCAAGA GGG Intergenic
No off target data available for this crispr