ID: 975156286

View in Genome Browser
Species Human (GRCh38)
Location 4:71076446-71076468
Sequence CACTTAAACCCGGGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975156280_975156286 8 Left 975156280 4:71076415-71076437 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 975156286 4:71076446-71076468 CACTTAAACCCGGGAGGAGGAGG No data
975156276_975156286 17 Left 975156276 4:71076406-71076428 CCTATAATCCCAGCTACTCAGGA 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419
Right 975156286 4:71076446-71076468 CACTTAAACCCGGGAGGAGGAGG No data
975156278_975156286 9 Left 975156278 4:71076414-71076436 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 975156286 4:71076446-71076468 CACTTAAACCCGGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975156286 Original CRISPR CACTTAAACCCGGGAGGAGG AGG Intergenic
No off target data available for this crispr