ID: 975172885

View in Genome Browser
Species Human (GRCh38)
Location 4:71252985-71253007
Sequence CACTGCACTGTGAAGTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975172885_975172890 19 Left 975172885 4:71252985-71253007 CCATAGCACTTCACAGTGCAGTG 0: 1
1: 0
2: 3
3: 30
4: 188
Right 975172890 4:71253027-71253049 CACCTGTGTGGAAGTGCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 219
975172885_975172889 18 Left 975172885 4:71252985-71253007 CCATAGCACTTCACAGTGCAGTG 0: 1
1: 0
2: 3
3: 30
4: 188
Right 975172889 4:71253026-71253048 ACACCTGTGTGGAAGTGCACAGG 0: 1
1: 0
2: 0
3: 14
4: 144
975172885_975172886 7 Left 975172885 4:71252985-71253007 CCATAGCACTTCACAGTGCAGTG 0: 1
1: 0
2: 3
3: 30
4: 188
Right 975172886 4:71253015-71253037 TGAACGCTCCCACACCTGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975172885 Original CRISPR CACTGCACTGTGAAGTGCTA TGG (reversed) Intronic
900767415 1:4514423-4514445 CACTGCAATGTGAAGAGGAAGGG + Intergenic
906643738 1:47458090-47458112 CCCTGCTCTGTGAGGTGCTTTGG - Intergenic
908579873 1:65503262-65503284 CTCTGTACTGTAAAGTTCTATGG - Intronic
909417316 1:75421515-75421537 CACTGCACTGTGGTGTGCTATGG + Intronic
909568730 1:77084340-77084362 AACTGCCCTTTGGAGTGCTAAGG + Intergenic
910172298 1:84390492-84390514 CAAAGCACTGTCAAGTGCTATGG - Intergenic
910564285 1:88625775-88625797 CTCTGCACTGTGAAGTTATGAGG - Intergenic
910792625 1:91066897-91066919 CACTGCACTTTGCAGTCCTAGGG + Intergenic
912550299 1:110481005-110481027 CACCACACTGTGAAGTGCTGGGG - Intergenic
913349659 1:117843158-117843180 CACTGCACTATAAAATGCTTTGG + Intergenic
917524537 1:175775281-175775303 CACTGCACTGTGGGGGGCTGAGG - Intergenic
920388729 1:205585798-205585820 GACTGCACTGTGGAGACCTAGGG - Intronic
920850830 1:209626965-209626987 CACTGCCCTGTGAACTGCGTGGG + Exonic
921800626 1:219398982-219399004 CACTGCACTATGAAATGCTTTGG - Intergenic
922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG + Intronic
923293648 1:232572147-232572169 TACTGCACTTTGGAGTACTATGG - Intergenic
924455369 1:244214840-244214862 CACTGGGCTGTGAAGGGCTAGGG + Intergenic
924502610 1:244651704-244651726 CACTGGACTGTGACTTGCTGTGG - Intergenic
1063275119 10:4557595-4557617 CACCGCACTGTGAAACGCTTTGG - Intergenic
1068397908 10:56487856-56487878 CACTGCCCAGTGAAGTGTTTTGG - Intergenic
1071191804 10:83109494-83109516 CACTGCATTATGAAGTGCTTTGG + Intergenic
1072420306 10:95285381-95285403 CACAGCTCTGAAAAGTGCTAAGG - Intronic
1073996987 10:109326649-109326671 AACTGCACTGTGACTTTCTAAGG - Intergenic
1074693884 10:116030416-116030438 CCCTGCAATGTGAGGTGCAATGG - Intergenic
1075500171 10:122965665-122965687 CACTGTGCTGGGAAGTGCTGTGG - Intronic
1076999390 11:315134-315156 CATTGCACAGTGGAGTGCAAAGG - Exonic
1078083830 11:8221969-8221991 ATCTGCACTATGAAGTGCTGTGG - Intergenic
1079793153 11:24765224-24765246 CACTGTACAGTGAAGTTATATGG + Intronic
1080073980 11:28126290-28126312 CATATCACTGTTAAGTGCTAAGG - Intronic
1080137681 11:28875903-28875925 AATTGTACTGTGAAGTGCTATGG - Intergenic
1080225071 11:29950739-29950761 CACTGCGCTATGAAATGCTTTGG + Intergenic
1080410810 11:32023273-32023295 ATTTGCACTGTGAAGGGCTAGGG - Intronic
1083006420 11:59351033-59351055 CAATGCACTATGAAGTGCTTTGG - Intergenic
1085856375 11:80181014-80181036 CACTGCACTGTGAAGCACTTTGG - Intergenic
1086446566 11:86877197-86877219 CACTGCACTGTGAGCTCCTTGGG + Intronic
1086859559 11:91909127-91909149 AACTGCACTGGGAGGTGTTATGG - Intergenic
1089690016 11:120181327-120181349 CAATGCAAAGTGCAGTGCTATGG - Intronic
1089883658 11:121798669-121798691 CACTGAACTCTGAAGCACTAAGG + Intergenic
1090162433 11:124510013-124510035 CACTGCACTATGAAATGCTTTGG - Intergenic
1092670093 12:10852962-10852984 CCCTGCAATGTAAGGTGCTATGG + Intronic
1093304397 12:17495252-17495274 CATTGCTCTGTAAAGTGCTTTGG - Intergenic
1095792892 12:46186435-46186457 AACAGCACAGTCAAGTGCTATGG - Intronic
1100946325 12:99787995-99788017 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1101724316 12:107376481-107376503 CACAACACTGTGAGGTGTTAGGG - Intronic
1103611095 12:122124455-122124477 CTCTGCACTGTGAAGAGCCGAGG - Intronic
1104967418 12:132514498-132514520 CACAGCTTTGTGAACTGCTAGGG - Intronic
1105809522 13:23982582-23982604 AACTCTACTGTGAAATGCTAGGG + Intronic
1105891872 13:24687905-24687927 CACTGCACTCTGCTCTGCTAAGG - Intronic
1106780411 13:33053580-33053602 CACCCCACAGTGAGGTGCTACGG - Intronic
1107133209 13:36919021-36919043 CAGGGCACTGTGGAGTGCTTTGG - Intronic
1109423272 13:62141250-62141272 CACTGGAATGATAAGTGCTAAGG + Intergenic
1110809538 13:79796334-79796356 AACTGCTCTCTGAAGTGCTCTGG - Intergenic
1114734945 14:25034553-25034575 CACTGCACTGTGCTGTACTGAGG - Intronic
1115942827 14:38628033-38628055 CACTGCAGTATGAAATGCTTTGG + Intergenic
1116194465 14:41705220-41705242 CACTACTCTGCGCAGTGCTATGG + Intronic
1117783496 14:59258577-59258599 CACTAGTCAGTGAAGTGCTAGGG + Intronic
1117853911 14:60007769-60007791 CAGTGCACTTTTAAGTGCAAGGG - Intronic
1118448725 14:65877237-65877259 CACTGCACTAAGAAATGCTTTGG - Intergenic
1119306811 14:73614345-73614367 CACTGTACTGTGAATTCCTGGGG + Intronic
1119473262 14:74912185-74912207 CCCTGCACTGTGCAGGGCTCCGG - Intronic
1121021329 14:90581943-90581965 CACAGCACTGAAAAGTGCCATGG - Intronic
1121951158 14:98172123-98172145 CTCTGCACTGGGCAGGGCTAGGG + Intergenic
1128564277 15:68689867-68689889 CACTGCAAAGTGATGTGCTGGGG + Intronic
1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG + Exonic
1130865504 15:87930160-87930182 CTCTCCACTGTGCACTGCTATGG - Intronic
1134590192 16:15446599-15446621 CACTCCACTGATAAGTGGTAGGG + Intronic
1135511888 16:23092432-23092454 CACCACACTGTGAAGTTCTCTGG - Intronic
1136278678 16:29194341-29194363 CACTGCACTGGAACGTGCTTGGG + Intergenic
1137449388 16:48556723-48556745 CACTGCCCTGTCTGGTGCTATGG - Intronic
1137524404 16:49221709-49221731 CACTGCTCTGTCAATTACTATGG + Intergenic
1137846448 16:51694127-51694149 CTTTGCACTGTAAAGTTCTATGG - Intergenic
1138318250 16:56088922-56088944 CACTGGACTGAGAAGCACTATGG + Intergenic
1140137367 16:72219290-72219312 CCTGGCACTGTGAAGGGCTAAGG + Intergenic
1142083069 16:88160422-88160444 CACTGCACTGGAATGTGCTTGGG + Intergenic
1143347525 17:6260909-6260931 GACTTCACTGTGACGTGGTAAGG - Intergenic
1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG + Intergenic
1144106052 17:11986359-11986381 CACTTCCCTTTGATGTGCTAGGG - Intronic
1144220183 17:13092673-13092695 AAATGCAATGGGAAGTGCTATGG + Intergenic
1144256081 17:13470084-13470106 CACTGCCCTTTGAAATGCTAAGG + Intergenic
1147136910 17:38439492-38439514 CAATGCAGTGTCAAGTGCTATGG - Intronic
1150128974 17:62656440-62656462 CCCTGCACTTTGAAAGGCTAAGG - Intronic
1151674733 17:75591595-75591617 CACTGCAGTGGGAGGAGCTAAGG - Intergenic
1153505591 18:5794550-5794572 CTCTGCATTGTGGAGTGCCAAGG - Intergenic
1156597521 18:38564509-38564531 CACTACACTGTGCAGTTCTAGGG - Intergenic
1157387841 18:47274389-47274411 GACTGCATTGGGAATTGCTAAGG + Intergenic
1159476510 18:68927721-68927743 CAATGCACTGTGAAGTTCATTGG + Intronic
1161826685 19:6572271-6572293 CACTGCAGGGTGGAGTGCTCTGG - Intergenic
1163247531 19:16106324-16106346 CAGTGAAGTGTGAAGTGCTGAGG - Intergenic
1163703749 19:18800469-18800491 AACTGAACTGTGGAGTCCTAGGG + Intergenic
1164433318 19:28207344-28207366 CAATGCACTGAGAAGTGGAAGGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165381383 19:35483375-35483397 CTTTGCACTGTAAAGTGGTAGGG - Intergenic
1168710621 19:58498048-58498070 AACTCCCCTGTGAAGTGCTGTGG - Intronic
927459807 2:23288540-23288562 CATTGCACTGTAAAATGCAAAGG - Intergenic
928288728 2:30018258-30018280 CACTGCCCTGGGAAGCACTATGG - Intergenic
933555172 2:83823018-83823040 CACTGCACTGTGAAATGCTTTGG - Intergenic
934996557 2:98967076-98967098 CACTGCCCTGTGAAGTACTTTGG - Intergenic
936895563 2:117423740-117423762 CACTTCACTGTGATATGTTAGGG - Intergenic
937065514 2:119013876-119013898 CACTAGACTGTGAAGTCCTGAGG - Intergenic
940504401 2:154534617-154534639 AACTGCATTGTGATATGCTATGG - Intergenic
941409819 2:165140715-165140737 CACAGCACTGTGGATTGCAATGG - Exonic
941483161 2:166043766-166043788 CACAGCACTGTGGATTGCAATGG - Exonic
942352216 2:175064945-175064967 CACCGCAGAGTGAAGTGCTCTGG + Intergenic
945657887 2:212647550-212647572 GACAGAACTGTGAACTGCTAGGG + Intergenic
948050980 2:234979080-234979102 CACTGTTCTGTGGGGTGCTAAGG + Intronic
948475594 2:238216956-238216978 CACTGCGGGCTGAAGTGCTATGG - Intergenic
1173709675 20:45143626-45143648 CACTGCAGGCTAAAGTGCTATGG - Intergenic
1173711828 20:45164668-45164690 CACTGCTCAATGAAGTGCTTTGG + Intergenic
1175445429 20:59016441-59016463 CACTGCAGGTTGAAGTGCTCTGG + Intergenic
1175604202 20:60299052-60299074 CTCTGCACTGTGAAGAGGTCAGG - Intergenic
1176969769 21:15252131-15252153 CACTAGACTGTGAAGTCCCAAGG - Intergenic
1177359048 21:20045556-20045578 CATTGCCCTGTGAAGTGCCCTGG + Intergenic
1178387283 21:32163145-32163167 CACTCCACTTTGAATTGCTCAGG - Intergenic
1179610811 21:42548711-42548733 CACTGGACTGTGTTGTGCAAGGG - Intronic
1184850544 22:47117118-47117140 CTCTGCAATGTGAAGTGATTTGG + Intronic
949235790 3:1806705-1806727 CACTGCAGGCTAAAGTGCTATGG - Intergenic
950770104 3:15304419-15304441 CACTGCACTGTGCAGAGCACAGG - Intronic
951222290 3:20081456-20081478 CACAGCACTGAGAGGTGCCAAGG + Intronic
952498047 3:33933391-33933413 CACTGCTCTGTGAAGGGAAAAGG - Intergenic
952599628 3:35064745-35064767 CACTGTAAAGTGAAGTGCTGAGG - Intergenic
953885898 3:46714235-46714257 CGCTGCACTGTGACGGGCTGGGG - Exonic
957859143 3:85921695-85921717 CTCTGCATTGTGTAGTTCTATGG + Intronic
959108239 3:102091001-102091023 AACTACTCTGTAAAGTGCTATGG - Intergenic
961860668 3:129914644-129914666 CACTGAACTGTGAAGGGTAAAGG - Intergenic
962366625 3:134790578-134790600 CAGTTGTCTGTGAAGTGCTAGGG - Intronic
964142808 3:153422534-153422556 CACTGCACTGTGAAATGCATTGG + Intergenic
965379162 3:167966949-167966971 CTCTGCAGACTGAAGTGCTATGG + Intergenic
966415472 3:179685018-179685040 CTAGGCACTGTTAAGTGCTAAGG - Intronic
969560407 4:7943205-7943227 CCCAGCACAGTGAAGTTCTAGGG + Intergenic
970032312 4:11690425-11690447 CACTGCTCTGTGAAATACTTTGG + Intergenic
972399143 4:38684389-38684411 CACTGCACTGTGAGGTGATGAGG - Intronic
972593082 4:40506526-40506548 CACTGCACTGGGAAGGGCAGAGG + Intronic
973879689 4:55256952-55256974 AGCTGCACTGTGAATTCCTAAGG + Intergenic
973897112 4:55424205-55424227 CACTGCTATGACAAGTGCTAGGG - Intronic
974309559 4:60187499-60187521 CACTGCAAGCTGAAGTGCTCTGG + Intergenic
974850946 4:67404678-67404700 CCCTGCACTGTCAAGAGCAAAGG + Intergenic
975172885 4:71252985-71253007 CACTGCACTGTGAAGTGCTATGG - Intronic
975754734 4:77561652-77561674 CCCTGCACTCTGGAATGCTAAGG - Intronic
975899159 4:79129578-79129600 CACTGCCCTATGAAGTGCTTTGG - Intergenic
976794341 4:88915663-88915685 AACTTCATTGTCAAGTGCTATGG + Intronic
976951276 4:90834452-90834474 CTCTGCACTGTAAATAGCTAAGG - Intronic
977174200 4:93799204-93799226 CAATGCACTGTTAAGTACCATGG + Intergenic
979158497 4:117429121-117429143 CACTGCACTGTGAAAGGCTTTGG - Intergenic
980257568 4:130402331-130402353 CACCACACTGTGAAATGCTCTGG - Intergenic
980285677 4:130776155-130776177 CACTGGAATGGGAACTGCTATGG + Intergenic
980583902 4:134788666-134788688 CACTACCCTATGAAGTGCTTTGG - Intergenic
981707608 4:147678072-147678094 CACTAGACTGTGCAGGGCTAGGG - Intronic
984144385 4:176043788-176043810 CATTGCACTATGAAATGCTTTGG - Intergenic
984639885 4:182150850-182150872 CACTGCATTCAGAGGTGCTACGG - Intronic
988917601 5:35910904-35910926 CCTTGCTCTGTAAAGTGCTATGG - Intronic
988956436 5:36324509-36324531 CACTGCAGGTTGAAGTGCTATGG - Intergenic
989080946 5:37620586-37620608 CACTGCAATAGGAATTGCTATGG - Intronic
994119191 5:96094717-96094739 CACTCTACTGTGAAGAGCTTGGG + Intergenic
994358946 5:98828106-98828128 CACTGCACTATGAAATGCTTAGG + Intergenic
995241889 5:109894537-109894559 CACTGAAATGTGCAATGCTATGG + Intergenic
995896156 5:117013457-117013479 CACTGCACTGTGTGGGGCTGAGG + Intergenic
996663231 5:126027954-126027976 CACTACACTATGAAATGCTTTGG + Intergenic
996933982 5:128927004-128927026 AACTATACTGTGAACTGCTAAGG - Intronic
997188066 5:131901554-131901576 CACTGCCCTGTGAAGAGCTTTGG + Intronic
997642853 5:135460818-135460840 TGCTGCACTGAGAAGTGCCATGG + Intergenic
998098196 5:139409646-139409668 CATTGCACTGGGGAGTGCTGTGG + Intronic
999658249 5:153831531-153831553 TAGTGTACTATGAAGTGCTAGGG - Intergenic
1001182644 5:169534792-169534814 CAATGCACTGTGAAGTTTGATGG - Intergenic
1002445945 5:179290038-179290060 CAGTGCAGTCTGGAGTGCTACGG + Intronic
1003137037 6:3441655-3441677 CAGTGCACTGTGAGGTGCCTTGG - Intronic
1003478346 6:6505979-6506001 CACTGCACTGAGCAGTGGGATGG + Intergenic
1003517029 6:6826151-6826173 CACTCCACTGTTAAGAGCTGGGG - Intergenic
1003563224 6:7201323-7201345 TAAAGCCCTGTGAAGTGCTACGG - Intronic
1004555871 6:16697510-16697532 CAGTGCTCTCTGAAGAGCTAAGG + Intronic
1004834102 6:19511455-19511477 TACTGCACTATGAAATGCTTTGG - Intergenic
1007314778 6:40978672-40978694 CACTGCCCTGTGAAGTGCTTTGG - Intergenic
1007358902 6:41341630-41341652 GACTGAACTGTGAAGTCCTCTGG - Intronic
1008690625 6:53974728-53974750 CACTGCACTTCCAAGTGCTGCGG + Intronic
1009558292 6:65203307-65203329 TACAGCAGTGTGCAGTGCTAGGG + Intronic
1009820681 6:68797235-68797257 CACTGGGCAGTGAACTGCTAGGG - Intronic
1010945484 6:81969486-81969508 CACTGCCCTTCGAATTGCTATGG + Intergenic
1011290477 6:85772006-85772028 CACTGCACTATAAAATGCTTTGG - Intergenic
1012668924 6:102015709-102015731 CACTGCCCTGCAAAGTGCTTTGG + Intronic
1014854398 6:126381707-126381729 CACTGCCCTATGAAGGGCTTTGG + Intergenic
1019751886 7:2735837-2735859 CACTGAACTGTAAGGTGCCAGGG + Intronic
1020800826 7:12730110-12730132 CACTGAACTGTAATGTGCCAAGG + Intergenic
1027505949 7:79017147-79017169 CACTGCCCTATGAAGTGCTGAGG + Intronic
1031080212 7:117250640-117250662 CACAGCACTGTGCAGTGAGAGGG - Intergenic
1031732554 7:125316541-125316563 CACTGCAGACTGAAGTGCTCTGG + Intergenic
1034703111 7:153113901-153113923 CACTTCCCAGTGAAGTGCTAGGG + Intergenic
1035743499 8:1945734-1945756 TCCTGCACTGGGAAGCGCTAAGG - Intronic
1036985831 8:13529890-13529912 CACTATACTGTGAAGAGCTAGGG + Intergenic
1039009970 8:33082852-33082874 CACAGCACTTTGAAATGCTGAGG + Intergenic
1039255766 8:35717494-35717516 CCCTGAACTGTGAAGTTCAAAGG + Intronic
1041404575 8:57483754-57483776 CACTGCACTATGAAATGCTTTGG + Intergenic
1042976637 8:74477719-74477741 CACTGCCCTTTGAAGTGCTTTGG - Intronic
1045948216 8:107821479-107821501 AACTGCAATGGAAAGTGCTATGG - Intergenic
1046338029 8:112815113-112815135 CACTCTACTGTGATGTGTTAGGG - Intronic
1047095601 8:121621873-121621895 CAATGCCCTTTGAAGTGGTATGG - Intronic
1048029393 8:130616653-130616675 CACTGCACTATGAAATACTTTGG + Intergenic
1048369620 8:133766117-133766139 CACTTCTCTGTGAGGTGCAAGGG + Intergenic
1049128199 8:140811113-140811135 CACCACACTGTGAAATGCTTTGG + Intronic
1049573083 8:143378620-143378642 CACTGCCCTGGGAAGTCCCATGG - Intronic
1050675908 9:8053038-8053060 CACTACCCTGTGAAGTGCTTTGG - Intergenic
1051169224 9:14302052-14302074 GTCTGCACTGTGAAATGCTCTGG - Intronic
1051714994 9:19973229-19973251 CACTGCAATGTGCAATGCCATGG + Intergenic
1052224362 9:26067080-26067102 CACACCGCTGGGAAGTGCTATGG - Intergenic
1057482588 9:95457015-95457037 CCCTGCACTTTGAAGAGCTGGGG + Intronic
1059053120 9:110950207-110950229 CCCAGCACTGTGAAGGGCTGAGG + Intronic
1062277853 9:135739144-135739166 CCCTGCCCAGTGCAGTGCTAGGG - Intronic
1186040095 X:5466507-5466529 CACTGCACTGGGAAGTGTTCAGG - Intergenic
1188707898 X:33357864-33357886 CACTGCCCAATGAAGTGCTTTGG + Intergenic
1188835463 X:34948765-34948787 CACTGCCCTGTGAAGTGATTTGG + Intergenic
1189363318 X:40369762-40369784 CACTGCTGTGTGCAGTGCAATGG + Intergenic
1190064619 X:47231403-47231425 AACTGCTCTGGGAAGTGGTAGGG + Intergenic
1190602734 X:52108957-52108979 CACTGCAGGCTAAAGTGCTATGG - Intergenic
1191099907 X:56714817-56714839 CACTGCACTATAAAATGCTTTGG + Intergenic
1193179113 X:78432643-78432665 CACTGAACTGTGAGCTCCTAAGG - Intergenic
1193483826 X:82060822-82060844 CACTGCCCTGTGAAGCACTTTGG + Intergenic
1193593618 X:83419810-83419832 CACAGCACTATGAAATGCTTTGG + Intergenic
1194525888 X:94977405-94977427 CACTGCACTGGGGAGAGCCAAGG + Intergenic
1194525894 X:94977472-94977494 CACTGCTCTGTGAAATGCTTTGG - Intergenic
1195123266 X:101779157-101779179 CACTGCACTGGGTGCTGCTATGG - Intergenic
1196473673 X:116058263-116058285 CCCTGAACTATGAAGTGCTTTGG - Intergenic
1196695251 X:118604467-118604489 CAATTCAATGTGTAGTGCTAGGG - Intronic
1198220094 X:134590871-134590893 CCCAGCACTGTGAAAAGCTAAGG - Intronic
1199325115 X:146490115-146490137 CACCGCACACTGAAGTGCTCTGG + Intergenic