ID: 975176951

View in Genome Browser
Species Human (GRCh38)
Location 4:71300046-71300068
Sequence ATGAAAAATGGGTTTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975176951 Original CRISPR ATGAAAAATGGGTTTGATTA AGG (reversed) Intronic
903567226 1:24277234-24277256 CTGTAAAATGGGTATGATGATGG - Intergenic
907178449 1:52547876-52547898 ATGGGAACTGGGTTTCATTATGG + Intronic
907511630 1:54965618-54965640 AAGAAAAAAGGGATTCATTAAGG + Intergenic
908054964 1:60275628-60275650 TTGTAAAATGGATTTGATTTTGG - Intergenic
908168970 1:61486058-61486080 ATAAAAAATGGGTTTCTTTATGG - Intergenic
908462433 1:64358292-64358314 ATGAGAAATGGGTTTCTTAATGG - Intergenic
908621019 1:65979628-65979650 CTGAAAAATGAATTTGCTTAAGG + Intronic
909009381 1:70316879-70316901 ATGAAAAATGTGTTAGAATCAGG - Intronic
909803240 1:79841261-79841283 ATGAATAATAGATTTGATTTTGG + Intergenic
910117304 1:83746262-83746284 ATTAAAATTGGGTTTTATTTTGG - Intergenic
910474334 1:87590697-87590719 AAGAAAGCTGGGTTTGAGTAGGG + Intergenic
910651900 1:89577810-89577832 ATTATAACTGGGTTTGAATAAGG - Intronic
911452912 1:98087820-98087842 ATAAAAATTGATTTTGATTATGG - Intergenic
912234385 1:107834148-107834170 ATGTAAAATGGGTTTATATATGG - Intronic
912625462 1:111202394-111202416 ATGAAACATGAGTTTGATGGAGG - Intronic
912993827 1:114513576-114513598 ATGAAAAATGGAGTTGATACAGG - Intergenic
913237938 1:116800957-116800979 ATGAAAGATAGGTTTGATGGAGG + Intergenic
914316090 1:146513161-146513183 CTGAAAAATGGGGTTTATAATGG + Intergenic
914498265 1:148220200-148220222 CTGAAAAATGGGGTTTATAATGG - Intergenic
914924249 1:151870611-151870633 CTGAAAAATATGTTTGACTAGGG + Intergenic
916997754 1:170319389-170319411 ATAAAAACTAGCTTTGATTAAGG - Intergenic
917598290 1:176551802-176551824 GTGAAGAATGGGTTTCTTTAGGG + Intronic
918808832 1:189088175-189088197 ATGATAAATGGGTTGCATTTTGG - Intergenic
921245125 1:213230302-213230324 ATCCAAAATAGGTTTTATTATGG - Intronic
921356464 1:214288955-214288977 CTGAAGAATGGATTTGCTTAAGG - Intronic
921576561 1:216841925-216841947 ATGAAAACTGGACCTGATTATGG - Intronic
921982330 1:221272288-221272310 ATCATAAATGGCTTTGATTGAGG - Intergenic
922979218 1:229811368-229811390 ATAAAAAATGTGATTGATTTTGG + Intergenic
923971908 1:239213152-239213174 ACGAAAAATGGAATTGATTTTGG - Intergenic
924138799 1:241000286-241000308 AAGAAAAATGGGTTTCAAAAAGG + Intronic
1062779696 10:190848-190870 AAGGAAAATGGGCTTGAATAAGG - Intronic
1063683575 10:8213775-8213797 AAGAAACAAAGGTTTGATTAAGG - Intergenic
1064754953 10:18565269-18565291 ATGGAAAATGTAATTGATTACGG - Intronic
1064809220 10:19176318-19176340 ATGAAAAATGTCTTTAATAAAGG - Intronic
1065394537 10:25220058-25220080 ATGAAAAATTGTTTAAATTAGGG + Intronic
1065481898 10:26203719-26203741 ATGAAAAATGGGAGTAATGATGG + Intronic
1065934002 10:30504278-30504300 ATGAAAAAGGGGGTGGTTTAGGG - Intergenic
1066114581 10:32228215-32228237 ACGGAAAATGGGTTAAATTAAGG - Intergenic
1066130173 10:32385619-32385641 ATAAAAAATAGCTTTAATTAAGG - Intergenic
1067995749 10:51271391-51271413 AGGGAAATTGGGTTTGCTTACGG + Intronic
1068637594 10:59364139-59364161 AAGAAAAACAGGTTTCATTAAGG + Intergenic
1069345882 10:67469414-67469436 AGGAAAAGTGGGTTTTTTTAAGG + Intronic
1071139743 10:82494674-82494696 ATGAAAAATGGGCTTTAGAAGGG - Intronic
1071670431 10:87604205-87604227 AGGAAAATTGGGTCTGATCATGG - Intergenic
1072771654 10:98145152-98145174 ATGAAAACAGTGTTTGACTAAGG + Intronic
1072922153 10:99585356-99585378 CTGAAAAATGGGAATGATAAAGG + Intergenic
1073585443 10:104705582-104705604 ATGATAAATGGTTTTGAGAATGG + Intronic
1074436562 10:113439299-113439321 ATGTTAAATGGGCTTAATTATGG + Intergenic
1075105563 10:119538060-119538082 ATGATAAAGGTGTTTGATGATGG + Intronic
1075443842 10:122500296-122500318 ATGAAAAAGGGGATTTATTGGGG + Intronic
1075499443 10:122959111-122959133 ACGAGACATGGGTTTTATTAGGG - Intronic
1077932370 11:6747049-6747071 ATGAGAAATGGTTTTGGTAATGG + Intergenic
1079293273 11:19208106-19208128 TTCCAAAATGTGTTTGATTATGG + Intronic
1080526101 11:33121046-33121068 ATGGAAAATGGAATTGATTTGGG - Intronic
1081239670 11:40689157-40689179 AAGAACAATGGTTTTGATTCTGG + Intronic
1081823143 11:46020335-46020357 ATGAAAAATTGGTTTGCTGCAGG - Intronic
1082945735 11:58757005-58757027 ATAAAAATTGGGTTTTATAATGG + Intergenic
1085956708 11:81406805-81406827 AAAAAAAATGGATTTGAATAGGG + Intergenic
1086010434 11:82096558-82096580 ATGATAAATAGGTTGGATGATGG + Intergenic
1087431484 11:98061839-98061861 CTGTAAAATGGATTTGATAATGG - Intergenic
1087713418 11:101581497-101581519 ATGAAAAAAGGTTTTGTTCATGG + Intronic
1088091911 11:106051038-106051060 ATCAAAAAGGGATTTGATTTTGG + Intergenic
1088577970 11:111290018-111290040 AAGAAAAATGGGGTTGGATAAGG - Intergenic
1090176939 11:124658485-124658507 TTGAAAAATGGGTTTCCTGATGG + Intronic
1090419741 11:126566276-126566298 AGGAAAAATGGATTGGAGTAGGG + Intronic
1090582580 11:128176313-128176335 CTGAAAAATGGAATTGATGATGG + Intergenic
1090986556 11:131771969-131771991 ATGAAAAATAGATTTGAAAATGG - Intronic
1091154854 11:133362852-133362874 AGGAGAAATGGCTTTGATTGTGG - Intronic
1091737109 12:2931986-2932008 ATGCAAAATAGGTTTGAATTTGG - Intronic
1091858283 12:3756352-3756374 AGGAAACTTGGGTTTTATTAGGG + Intronic
1092703139 12:11255875-11255897 ATGAACAATGCCTTTGATTTTGG + Intergenic
1093188217 12:16046176-16046198 ATGAAAAATGGTTTAGTTTGCGG + Intergenic
1093202740 12:16209055-16209077 ATGAAAACTAGATTGGATTAAGG - Intronic
1093474492 12:19539621-19539643 ATGAAAAATGGGAGTGACCATGG + Intronic
1093559166 12:20517332-20517354 ATGAAGAAGGGGTTGGACTATGG + Intronic
1097460258 12:59853418-59853440 ATGAATTATGGCTGTGATTAAGG - Intergenic
1098088422 12:66873831-66873853 ATGAAAGATGGTGTTGATAATGG + Intergenic
1098234291 12:68403625-68403647 ATGTAAAATGGGTTCTATAATGG - Intergenic
1098245249 12:68510563-68510585 ATGAATAATGGTTTTATTTATGG - Intergenic
1098880776 12:75914940-75914962 TTTAAAAATAGGTTTAATTATGG + Intergenic
1099009554 12:77275934-77275956 ATGAAGAATGGATTTGAAGAAGG + Intergenic
1099241418 12:80143504-80143526 ATGAAAAATGGGAGAAATTAAGG - Intergenic
1101590669 12:106122405-106122427 CTGAAAAATGGGGATGATAATGG + Intronic
1104041098 12:125131560-125131582 ATGAATAATGAGTATGAATATGG + Intronic
1104649248 12:130519736-130519758 TTGAAATAGGGGTTAGATTATGG + Intronic
1105061746 12:133158968-133158990 ATCAGAAATGGTTTTCATTAAGG + Exonic
1105814840 13:24025665-24025687 ATATAAAATGGATTTTATTACGG + Intronic
1105930928 13:25050883-25050905 CTGATAAATTGTTTTGATTAAGG - Intergenic
1106310787 13:28552324-28552346 ATGAAAACAGGCTTAGATTATGG - Intergenic
1106818120 13:33432081-33432103 AGGAAAAATAGGGGTGATTAAGG + Intergenic
1107096006 13:36536511-36536533 TTGCTAAATGGTTTTGATTATGG - Intergenic
1107657670 13:42608583-42608605 ATGAAAAGTGCCTTAGATTATGG - Intergenic
1109527383 13:63594131-63594153 ATCAAAAACAGGTTTGAATAGGG - Intergenic
1109667211 13:65554489-65554511 ATAAAATATGGTTTTGATTTGGG + Intergenic
1109899094 13:68739526-68739548 GTTAAAAATAAGTTTGATTAGGG - Intergenic
1110341679 13:74399238-74399260 GTGAAAAATAAGTTTTATTATGG + Intergenic
1110827130 13:79985534-79985556 ATCAACAATGTATTTGATTAAGG - Intergenic
1113063529 13:106350775-106350797 CTGAAAAATGGGATCAATTATGG + Intergenic
1113265552 13:108613074-108613096 TGGAAAGATGGGATTGATTATGG + Intronic
1114962448 14:27910715-27910737 ATGAGTATTGGGTTTGATTTTGG + Intergenic
1115975418 14:38991608-38991630 ATGAAAAATACATTTGAATAGGG - Intergenic
1116202360 14:41814387-41814409 TTGAACAATAGGTTTAATTAAGG + Intronic
1118823814 14:69362640-69362662 CTGAAAAATGGGTATGATGTGGG + Intergenic
1120584464 14:86294675-86294697 CTGGAAAATGGGATTGATGATGG + Intergenic
1122410514 14:101523430-101523452 TTGTACAATGGGGTTGATTAGGG - Intergenic
1122964180 14:105113636-105113658 ATTAAAAATGGGGTTGAGTGCGG + Intergenic
1124048153 15:26170089-26170111 GTGAAAAATTGGTTTCCTTAAGG - Intergenic
1124693880 15:31847335-31847357 ATGAAAAAAGGGTGTGATCATGG + Intronic
1124811295 15:32941579-32941601 ATGAAAAGTGAGTATGATAAGGG - Intronic
1125067525 15:35507556-35507578 ATGAAAAATTGTTTTGCTTATGG - Intronic
1127480098 15:59370742-59370764 ATGAAAAATGAGTTTAACTGAGG + Intronic
1127884214 15:63184928-63184950 ATGAAAAATTGGTATTTTTAAGG + Intergenic
1128877931 15:71217225-71217247 AATAATAATGTGTTTGATTATGG - Intronic
1129530732 15:76262459-76262481 AAAAAAAGGGGGTTTGATTATGG - Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133867731 16:9659658-9659680 ATGGAATGTGGGTTTGATTCCGG + Intergenic
1134935347 16:18240783-18240805 ATGAAAAGGGGAGTTGATTAAGG - Intergenic
1135794218 16:25425915-25425937 ATTAAAAATGGGTATTAATATGG + Intergenic
1136461066 16:30410434-30410456 ATGAGAACTGGGGTTGATCAGGG + Intronic
1137393471 16:48100602-48100624 AGTAAAAATGTGTTTGATTCAGG - Intronic
1138173845 16:54877963-54877985 AGGAAAGATGAGTTTGACTATGG + Intergenic
1138986614 16:62336798-62336820 ATGAGAAATAGGTTTGTTTTTGG + Intergenic
1141274830 16:82577898-82577920 ATGAAAAGTGTGTTTGTGTATGG - Intergenic
1141379124 16:83559690-83559712 GTGAAAAATGGGTAGAATTAAGG - Intronic
1141708920 16:85686523-85686545 ATGAAAATTGGGATTGATGGAGG - Intronic
1142315048 16:89338365-89338387 TTGAAACATGGGTTTGAAAAGGG + Intronic
1147158345 17:38556737-38556759 CTGAGTAATGGGTTTGATAATGG + Intronic
1147181114 17:38686279-38686301 AAGAAAAAAGGTTTTGAATACGG - Intergenic
1149277163 17:55054648-55054670 CTGCAAAATGGGTTTGATAATGG + Intronic
1150494096 17:65593878-65593900 TTAAAGAATGGGTTTAATTAGGG + Intronic
1153349952 18:4068198-4068220 ATGCAATATGGGCTTGATGAGGG + Intronic
1153842025 18:9015928-9015950 ATGAGAAATGTGTATGATAAAGG - Intergenic
1153955094 18:10089336-10089358 ATAAAAACTGGGCTTGATGAAGG + Intergenic
1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG + Intronic
1156850337 18:41718619-41718641 ATAAAAATTGGCTTTGATCAGGG - Intergenic
1158036212 18:53033943-53033965 ATGAAGATTGGGTTTCATGAAGG - Intronic
1159505121 18:69326682-69326704 ATGAAGAATGTGTTTTAATAAGG - Intergenic
1159800989 18:72898959-72898981 ATAATAAATGGGTTTTATTGAGG + Intergenic
1159864680 18:73690218-73690240 ATAAAACATGGGTTTTATTTGGG - Intergenic
1160043523 18:75366884-75366906 ATGTAAAATGGGGTTAATAACGG + Intergenic
1161920290 19:7260771-7260793 CTGAAAAATGGGGGTCATTATGG - Intronic
1164510264 19:28890782-28890804 CTGAAAAATGGGTTTCATAATGG - Intergenic
1167807302 19:51797084-51797106 AGGAAAAATGTGTTTGAAAAGGG + Intronic
1168221390 19:54963042-54963064 GTGAAAAATGGGTAGGATCATGG + Intronic
926901797 2:17759539-17759561 AAGAAAAATGGGGTTAATAAAGG - Intronic
927301309 2:21519019-21519041 GTGAAAAATGTATTTGATCAAGG - Intergenic
928615310 2:33032250-33032272 ATCAAATCTGGTTTTGATTATGG - Intronic
929909358 2:46075776-46075798 ATCAAAAAGGGATTTGACTAAGG + Intronic
930331170 2:49986701-49986723 ATGATAAATGTGTGAGATTATGG - Intronic
930514511 2:52389149-52389171 ATGAAAAATGGGTTAGATGCTGG + Intergenic
931053440 2:58440146-58440168 ATTAAAAATGAGTTAGATGACGG - Intergenic
931511533 2:63001013-63001035 ATGAAAAATGGAGTTTATAATGG + Intronic
932509812 2:72274728-72274750 ATCCAAAATGGCTTTTATTACGG - Intronic
933103723 2:78293970-78293992 AAAAAAAATGGTTTTGTTTAGGG - Intergenic
933863956 2:86499313-86499335 ATGAATAAATGGTTTTATTAGGG + Intergenic
934593363 2:95579285-95579307 ATGAAAAACGGATTTGATGAAGG - Intergenic
936790999 2:116151870-116151892 ATGAAAAATGGGATTAAATCAGG - Intergenic
938663912 2:133514210-133514232 ATGAAAAATATGTTTCATTGTGG - Intronic
939182127 2:138815982-138816004 CTGTAAAATGGGGTTGATAATGG - Intergenic
939462075 2:142509990-142510012 ATGAAACATGAGTTTGAGTAAGG - Intergenic
939864110 2:147453500-147453522 ATTGAAAATGGTTTTGATTCTGG - Intergenic
940016485 2:149111399-149111421 ATGAAAAATCAGTCTGATTTGGG + Intronic
940052563 2:149479776-149479798 ATGAAAAATGGATTGAAATAGGG - Intergenic
940478551 2:154197951-154197973 ATATAAAATGGGGTTTATTACGG - Intronic
940721270 2:157285078-157285100 CTGAAAAATGGGTTCCATTTGGG - Intronic
941584592 2:167341761-167341783 AAGAAAAATGAGTCTGATGAAGG - Intergenic
942647227 2:178125764-178125786 GTGAAAAAGGAGTTAGATTAAGG + Intronic
943604260 2:189957702-189957724 GTGAAAAATAGTTTTGAATAAGG + Intronic
944409182 2:199420452-199420474 ATGAAAAATTGGTTATTTTAGGG + Intronic
944431093 2:199634273-199634295 ATGGAAAAATTGTTTGATTATGG + Intergenic
944431383 2:199637323-199637345 AAGAAAAATGGATTTTAGTAAGG + Intergenic
944927011 2:204475821-204475843 GGGAAATATGGGTTTGGTTATGG + Intergenic
945310300 2:208304779-208304801 AGTAAAAATGGGTTTTATCAGGG - Intronic
946454135 2:219808727-219808749 ATGAAAAATGTTTTAGATGATGG - Intergenic
948286650 2:236791315-236791337 ATGAAATATGCCTTTGATTAAGG + Intergenic
948324823 2:237106377-237106399 ATGATAAATGTGTGTGATGATGG + Intergenic
1169897436 20:10519030-10519052 ATGAAAAATGTGCTTTATTGAGG + Intronic
1170313212 20:15014903-15014925 ATAAAAACTGGGTTTGTATAAGG - Intronic
1173967552 20:47124579-47124601 ATGGGAGATGGGTTTGTTTATGG - Intronic
1174443351 20:50573823-50573845 ATGAAAATTTGGTTTCATTTAGG - Intronic
1174690016 20:52494809-52494831 ATAGAAAATAGGTTTCATTATGG - Intergenic
1175573401 20:60041162-60041184 AAGAAAAATGGTTCTGATGAAGG + Intergenic
1176017336 20:62941820-62941842 CTGAAAAATGGGTTTGTGTTAGG - Intronic
1179249304 21:39659579-39659601 CTGTAAAATGGGTATGATCAAGG - Intronic
1180597406 22:16987693-16987715 ATGAAAATTTTGTTTGATTGTGG - Intronic
1181496758 22:23291674-23291696 ATGAATAATAGGTTTGGTTTGGG - Intronic
1181547287 22:23609333-23609355 ATCATAAATGGGTATGATTTTGG + Intronic
1181943040 22:26493722-26493744 AGGTAAAATGGGGCTGATTAAGG + Exonic
1182089966 22:27587792-27587814 ATGGAATCTGGGTTTGGTTAGGG - Intergenic
1182428770 22:30288484-30288506 ATGTAAAATGGGTATAGTTATGG - Intronic
1182701201 22:32240120-32240142 ATGGAAAATTGGTTTGAATTGGG + Intronic
1183193865 22:36339785-36339807 CTGAAAATTGGGTTTGAGTCAGG + Intronic
949130941 3:499696-499718 ATGAAAAATGTGTTTTTTTAAGG - Intergenic
949243981 3:1903799-1903821 TTTAAAAATGTGTTTGATTTGGG + Intergenic
949461716 3:4301969-4301991 CTGAAAAGTGGGTGTGATTCAGG - Intronic
949711659 3:6877399-6877421 ATGAAAAGTGGGTATGTTCATGG + Intronic
949838239 3:8292251-8292273 ATGAAAAATGGAATTGATTCTGG - Intergenic
951367094 3:21796692-21796714 ATGACATTTGGGTTTGATGATGG + Intronic
952187233 3:30983132-30983154 CTGAAAAATGGGTATGATCTTGG + Intergenic
952278483 3:31900947-31900969 ATGAAAAATAAATTTGATTAAGG + Intronic
952486920 3:33821559-33821581 ATGAGGAATTGGTTTGATTGTGG + Intronic
953483864 3:43275861-43275883 ATGAAATTTGGGTTTGGGTAGGG + Intergenic
955341226 3:58126807-58126829 CAGGAAAATGGGTTTGATTTTGG + Intronic
955438395 3:58929641-58929663 AATAAAAATGAGCTTGATTATGG - Intronic
955944015 3:64174055-64174077 ATAAAAAAGGAGTTTTATTAAGG - Intronic
957749730 3:84398533-84398555 AAGCAAAATGAGTTTGATTCAGG + Intergenic
958705726 3:97652570-97652592 ATCAAAAATAGGTTTGAGTGGGG + Intronic
958752966 3:98214499-98214521 ATGAAAAATGGGTATTTCTATGG - Intergenic
959117883 3:102198827-102198849 ATGGAAAATGGGTTTTAATCAGG - Intronic
959393673 3:105808199-105808221 ATGAAAAATGGCTTTGTAGAAGG - Intronic
959594045 3:108109416-108109438 ATTAAAAATGGGTTTCACAATGG + Intergenic
959854919 3:111141217-111141239 ATGAAGAATGGGATTATTTATGG + Intronic
960310909 3:116115339-116115361 CTGAAAAATGGGGATCATTAGGG - Intronic
960368324 3:116802505-116802527 AGGAAAAATGGCTTTTTTTATGG + Intronic
962011648 3:131397324-131397346 AGGGAAGATGGGTTTGCTTAAGG - Intergenic
962160571 3:132995258-132995280 ATGAAACAGGTGTTTTATTAAGG - Intergenic
963446706 3:145420387-145420409 AAGAAAAATCTGTTTGATTAAGG + Intergenic
964269218 3:154937268-154937290 TTGGAAAATGGATTTGATAAAGG - Intergenic
964406931 3:156358784-156358806 GTGAAACATGGTTTTGATGAAGG + Intronic
964593673 3:158396919-158396941 ATGTAAAATGGGGTTAATAAAGG - Intronic
966984870 3:185170419-185170441 AAGAAAAATGGGCTTGAACAAGG - Intergenic
967069936 3:185953716-185953738 ATGTAAAATGGGTGTAATAATGG - Intergenic
967525972 3:190493092-190493114 ATTAAAAATGGATCAGATTACGG + Intergenic
967672200 3:192250264-192250286 AAGAAAAACAGTTTTGATTAGGG + Intronic
970949009 4:21730591-21730613 ATGAAAAATAAGTTTCATGAGGG + Intronic
971138167 4:23892983-23893005 AGAAAAAATGGGTTTGATTTGGG - Intronic
973077664 4:45950053-45950075 ATGTATCATTGGTTTGATTATGG + Intergenic
974107575 4:57487822-57487844 TTGAAAAATGTGTTTCTTTAGGG + Intergenic
974319293 4:60324163-60324185 GTGAAAAATCCTTTTGATTATGG + Intergenic
974871253 4:67646165-67646187 AGGAAAAATGGATTTCTTTATGG - Intronic
975176951 4:71300046-71300068 ATGAAAAATGGGTTTGATTAAGG - Intronic
975795640 4:78004208-78004230 ATGAAAAACAGATATGATTAAGG - Intergenic
977148353 4:93475794-93475816 CTGAAAAATGGGGTTGCTAATGG + Intronic
977333999 4:95672977-95672999 ATGAATTATGGTTTGGATTAGGG + Intergenic
977776656 4:100929171-100929193 ATATAAAAGGGGTTTTATTAAGG + Intergenic
977870498 4:102084640-102084662 ATGAAAGATGTGTTTAATGAAGG - Intergenic
979793661 4:124817150-124817172 AAGAAGAATGTGTTTGAATAAGG - Intergenic
981038814 4:140201246-140201268 ATCAAAAATGGGTTTGTTATAGG - Intergenic
981038869 4:140202152-140202174 ATCAAAAATGGGTTTGTTATAGG + Intergenic
981091378 4:140736143-140736165 AGGAAAATTGGGTTTTATTAGGG + Intronic
981394359 4:144229667-144229689 GTGACAAATGGGGTTCATTAAGG + Intergenic
981894588 4:149783205-149783227 ATGAAGAATAGGTTTTATTGTGG - Intergenic
982049315 4:151484604-151484626 GTGGAAAATGGGTTTGAAGATGG + Intronic
982093199 4:151897807-151897829 ATGCAAATTGGCTTTGATTCTGG + Intergenic
983586381 4:169359501-169359523 ATGTAAAATGGGTTTCTTTTGGG - Intergenic
983798742 4:171900898-171900920 CAGAAACATGGATTTGATTAAGG + Intronic
984068976 4:175087463-175087485 ATGGATGATGGGTTTAATTAAGG - Intergenic
985200011 4:187475198-187475220 TTGAAGAATGGGTTGGATTCAGG - Intergenic
985353401 4:189091571-189091593 ATTAAAACTGGGTTTGAATCTGG - Intergenic
986692925 5:10328700-10328722 TTGATAAAGGGGTTTGATGATGG - Intergenic
986778239 5:11039361-11039383 ATGAGAAAGGGGTTTTCTTATGG - Intronic
987282971 5:16428809-16428831 CTGAAAAATAGGTTTGGTGAGGG + Intergenic
987378721 5:17263145-17263167 TAGAAAAATAGATTTGATTAGGG - Intronic
988121674 5:26971987-26972009 ATTAAATATTGGTGTGATTAGGG + Intronic
990206960 5:53440189-53440211 TTGAAAAATGGGTAAGATTTAGG + Intergenic
990606869 5:57419489-57419511 AAGAAATATGGATTTGAATATGG + Intergenic
991711392 5:69412320-69412342 ATGAACAATGGTTTTAAATATGG - Intronic
993256888 5:85603146-85603168 ATGCAAAATGTGTTTAACTAAGG - Intergenic
993771350 5:91931739-91931761 AAGAAAAATAGGTTTGTGTATGG - Intergenic
995076644 5:107992732-107992754 ATAAAAAATGCTTTTGTTTATGG - Intronic
995346371 5:111123838-111123860 ATGAAAAATGGTGCTGATTTGGG - Exonic
995537819 5:113154858-113154880 ATGAAAAATGTTTGTGATGATGG - Intronic
996110074 5:119555117-119555139 ATGTAAAATGTTTTTGATAAAGG + Intronic
996460603 5:123736576-123736598 CTGTAAAATGGGAATGATTATGG - Intergenic
999215762 5:149933623-149933645 TTGAAAAATAGGGATGATTATGG - Intronic
999591035 5:153146538-153146560 ATGAAAACTTGGTTTTATGAAGG + Intergenic
999698888 5:154209886-154209908 AAAAAAAATGTGTTTGATTATGG - Intronic
999760810 5:154699636-154699658 CATAAAAATGGGTTTGCTTAGGG + Intergenic
1000151879 5:158510775-158510797 ATGGAAAATGGGTTAGAGTAGGG + Intergenic
1002336075 5:178479210-178479232 CTGTAAAATGGGTATGAATAAGG - Intronic
1002707048 5:181168849-181168871 ATGAAAAATTGGTTTGCTTTAGG + Intergenic
1003241681 6:4350722-4350744 ATAAACAATGGGTTTTTTTAAGG + Intergenic
1003344990 6:5258817-5258839 ATTGAAAATGGGTTTCAGTATGG - Intronic
1004246043 6:13977058-13977080 TTGAAGAATGGCTTTGATTAAGG - Exonic
1005582074 6:27245054-27245076 ATGGAAAAAGGGTTTGAACAGGG - Intergenic
1006531783 6:34661698-34661720 ATGATAAAAGGGTTTCTTTAAGG - Intronic
1007303577 6:40887177-40887199 ATGAAAAAGGGCTTTGGTGATGG - Intergenic
1007377554 6:41467077-41467099 ATGATTAAAGGGTTTCATTACGG - Intergenic
1008033101 6:46719063-46719085 ATTAAATATGGATTTGATTGAGG - Intronic
1008298146 6:49803430-49803452 ATAAAACATGGTTTTTATTATGG - Intergenic
1008486895 6:52046341-52046363 AGGAAAAAATGGTTTAATTATGG - Intronic
1010605030 6:77878085-77878107 TTGAAAGATTGGTTTGATTCAGG + Intronic
1011095799 6:83660644-83660666 ATTAACAATTAGTTTGATTATGG + Intronic
1013149906 6:107434974-107434996 ACAAAAAATCAGTTTGATTAGGG + Intronic
1013505124 6:110792358-110792380 AAGAAAAATTGGTTTGATGATGG - Intronic
1013942522 6:115681792-115681814 ATGAGACAGGGGTTTCATTATGG - Intergenic
1013995906 6:116307646-116307668 ATGAAAGATGAGTTGGAGTAAGG - Intronic
1015057413 6:128920554-128920576 TTGGGAAAAGGGTTTGATTAGGG - Intronic
1017439584 6:154451121-154451143 ATGGTAAATGGGTTCGCTTACGG + Intronic
1017448592 6:154532028-154532050 AGCAAAAATGGGTCTGGTTAAGG - Intergenic
1018898610 6:168039059-168039081 ATGAAAATTGTGTATGTTTAAGG - Intronic
1019068016 6:169318975-169318997 ATGAAAACTGTGTGTGCTTAAGG + Intergenic
1021143936 7:17062175-17062197 ATTAAAAATGGGTATTTTTATGG - Intergenic
1021207743 7:17806573-17806595 ATGAAAAATGTGTGTTATTGTGG + Intronic
1021395320 7:20140370-20140392 ATGAAAAATGGGGGTGATGCTGG + Exonic
1022496446 7:30855924-30855946 ATGAAAAATGAATTTGGTGAGGG - Intronic
1024754248 7:52510584-52510606 ATGAGGAATGGGTTTGGTGAGGG + Intergenic
1026444538 7:70472573-70472595 ATTAAAAATGTGTTTGCTAATGG + Intronic
1027491261 7:78830067-78830089 AAGAAAAATTATTTTGATTATGG - Intronic
1027789599 7:82621873-82621895 TTGAAAAATGGGTTTCATTTAGG + Intergenic
1028601945 7:92610795-92610817 ATGATAAATGGTTTTGGGTAAGG + Exonic
1028659958 7:93259845-93259867 ATGAAAAATGAGTTTCAATGAGG - Intronic
1030155428 7:106449581-106449603 ATGAAAGATGGTTTGGATCAAGG - Intergenic
1031373575 7:120997210-120997232 ATGAAACATAAGTTTTATTAGGG - Intronic
1032542599 7:132715743-132715765 ATTAAAAATGGATTGGATTTAGG - Intronic
1033830689 7:145248589-145248611 ATGAAACATGGCTTTGTTTATGG + Intergenic
1034819012 7:154199429-154199451 ATGAATAATTGATTTGCTTAAGG + Intronic
1035130489 7:156648183-156648205 ATGGAAAATAGGTTTGGTTGAGG + Intronic
1036037997 8:5041070-5041092 ATATAAAATGTGTTTGATAAAGG - Intergenic
1037075240 8:14707911-14707933 ATGGAAAATGGGTATGATTTGGG + Intronic
1037175276 8:15939694-15939716 GTGAGAAATGAGTTTCATTAGGG - Intergenic
1037441619 8:18922180-18922202 ATGAAAAAACGGTTTGTTCAGGG + Intronic
1037601278 8:20396320-20396342 ATGTAAAATATGTATGATTATGG - Intergenic
1038047885 8:23781728-23781750 AAGAAAAATTGGTTTCATCATGG - Intergenic
1038623825 8:29171080-29171102 ATGAAAAGTGGCCTTCATTAGGG + Intronic
1039254946 8:35708907-35708929 ATGGGAAAAGGATTTGATTAAGG - Intronic
1039412815 8:37369657-37369679 ATGAAAAATGTTTTTAATTAGGG - Intergenic
1039579478 8:38652093-38652115 ATGCAGAATGGTTTTGATTTGGG - Intergenic
1039759197 8:40556403-40556425 TTGAAAAATTGGATTGATGATGG - Intronic
1041193896 8:55381345-55381367 ATGAGAGATGGGATTTATTAGGG + Intronic
1041970242 8:63732962-63732984 GTGAAGAATGGGTTTGAAGAAGG - Intergenic
1042694430 8:71540658-71540680 TTGAAAAATGGGTTATATTTTGG + Intronic
1043083090 8:75791402-75791424 ATGTAAAATGGGGTTAATAATGG + Intergenic
1043494236 8:80782681-80782703 CTGAAAAAAGGGTTTCATTAAGG + Intronic
1043765510 8:84126502-84126524 ATGAACAGTGGTTTTGATTAAGG + Intergenic
1043786656 8:84410353-84410375 CTGTAAAATGGGATTCATTATGG + Intronic
1043839175 8:85082083-85082105 ATGAAGAATGCCTTTGATGATGG - Intergenic
1044039767 8:87353119-87353141 ATGGAAAATGAGTTTGACTCAGG - Intronic
1044057023 8:87584173-87584195 GTCAAAAATGGCTTTGAGTAGGG + Intronic
1044076858 8:87832339-87832361 ATGAAAAAAGCCTTTGCTTATGG - Intergenic
1046333840 8:112756685-112756707 ATGAAAAATGCGGTTTGTTATGG + Intronic
1046518392 8:115292765-115292787 ATGCAAAAAGGGTTGGAGTAGGG - Intergenic
1046747974 8:117896588-117896610 ATTAAAAATGGGTTTCCATAAGG + Intronic
1047534187 8:125704239-125704261 ATGAAAAATGGGTCAGATAGAGG - Intergenic
1047677396 8:127218008-127218030 ATGAAAAATTGGATTTATAATGG + Intergenic
1047997499 8:130350578-130350600 ATGCCAAATGTGTTTGATTTTGG - Intronic
1049938954 9:526332-526354 TTGAAATATGGCTTTTATTATGG + Intronic
1050671425 9:8002079-8002101 ATAAAAAATGGATTTCATTGAGG + Intergenic
1051429902 9:16971242-16971264 ATAATAAATGAGTTTGATTTTGG - Intergenic
1051796357 9:20875726-20875748 TTGAAAAATATGTTTGATTGTGG + Intronic
1053383835 9:37671238-37671260 TTGCAAAATGAGTTTGATTTAGG - Intronic
1054930807 9:70633368-70633390 AAGAGAAATGGGTTTGTTGAGGG + Intronic
1055591135 9:77815185-77815207 ACAAAAAATATGTTTGATTATGG - Intronic
1055939129 9:81632677-81632699 ATGAAAAATGAGTGTGACTTAGG + Intronic
1056432927 9:86546682-86546704 CTGAGAAATGAGTCTGATTATGG - Intergenic
1056464922 9:86844361-86844383 CCAAATAATGGGTTTGATTATGG + Intergenic
1057453139 9:95183156-95183178 TTGAAAGATGGGTATGATTTTGG - Intronic
1057587809 9:96345480-96345502 CAGAAAAGTGGGTTTGATTAGGG - Intronic
1058145514 9:101406691-101406713 ATGAAAAAGGAGCTTGTTTAGGG + Intronic
1058407331 9:104691525-104691547 ATGAGACATGGGGTTTATTAGGG - Intergenic
1186543929 X:10429066-10429088 ATGGAAAATAGGCTTCATTATGG + Intergenic
1187251405 X:17601519-17601541 AAGACAAATGGATTTGATGATGG + Intronic
1187385947 X:18848525-18848547 ATGAAATTTGGATTTGACTAAGG + Intergenic
1187477191 X:19622014-19622036 TTTAAAAATAGTTTTGATTAAGG - Intronic
1188250789 X:27891715-27891737 ATAAAAAATGTGTATGTTTAAGG - Intergenic
1188340370 X:28993312-28993334 ATAAAAAATGGGTTAGAAGAGGG + Intronic
1190738503 X:53271713-53271735 ATGAAAAATGGGTTGTATGCAGG - Intronic
1191709988 X:64139529-64139551 AAGAAAATTGGGTTGGTTTAAGG - Intergenic
1192130036 X:68541197-68541219 ATGAGAAATGGATTTGAGCAGGG - Intergenic
1194894938 X:99429229-99429251 ATGAAGAATGGGTTGGACGATGG - Intergenic
1197507742 X:127329089-127329111 ATGATAAATGTGTTTGGTTTTGG - Intergenic
1197777437 X:130128162-130128184 TTAAATATTGGGTTTGATTAAGG - Intergenic
1198141034 X:133803607-133803629 ATGAAAAATAGGTCTGATTCAGG + Intronic
1198685107 X:139220559-139220581 ATGAGAAATGGGGTAGATTTGGG + Intronic
1199417365 X:147600582-147600604 ATGAATTCTTGGTTTGATTATGG - Intergenic
1201310694 Y:12596157-12596179 ATGGAAAATGGGTTGGTTTGAGG + Intergenic
1202059480 Y:20871413-20871435 ATCAAGATTGGGTTTGTTTAAGG + Intergenic