ID: 975177188

View in Genome Browser
Species Human (GRCh38)
Location 4:71301412-71301434
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975177179_975177188 9 Left 975177179 4:71301380-71301402 CCCTTGAAGCCACAGTCTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 165
Right 975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG No data
975177181_975177188 8 Left 975177181 4:71301381-71301403 CCTTGAAGCCACAGTCTTGGGGC 0: 2
1: 0
2: 5
3: 23
4: 167
Right 975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG No data
975177182_975177188 0 Left 975177182 4:71301389-71301411 CCACAGTCTTGGGGCCAGTCTGA 0: 1
1: 0
2: 0
3: 11
4: 189
Right 975177188 4:71301412-71301434 CGGAGTTAGGAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr