ID: 975182201

View in Genome Browser
Species Human (GRCh38)
Location 4:71359087-71359109
Sequence AATTAGGAACAGATGGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975182195_975182201 22 Left 975182195 4:71359042-71359064 CCAATATGATGAGCTTCATTTCC 0: 1
1: 0
2: 2
3: 8
4: 158
Right 975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG 0: 1
1: 0
2: 1
3: 20
4: 197
975182198_975182201 1 Left 975182198 4:71359063-71359085 CCATGGAACTGCAGGCAGAGTAG 0: 1
1: 0
2: 2
3: 20
4: 201
Right 975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG 0: 1
1: 0
2: 1
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975182201 Original CRISPR AATTAGGAACAGATGGATCT TGG Intronic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
901432344 1:9224706-9224728 AATTTGTAACAGAAGGTTCTAGG - Intergenic
902136247 1:14308450-14308472 AAGTAAAAACAGGTGGATCTGGG + Intergenic
905612104 1:39362451-39362473 AATTAGCAACTGGTGAATCTAGG - Intronic
907508267 1:54938253-54938275 AATTAGAAAAAGCTGGCTCTAGG - Intergenic
908684697 1:66702598-66702620 AATGAGAAACAAATGCATCTTGG - Intronic
908695899 1:66841506-66841528 ATTTAAAAACAGATGGATCTTGG - Intronic
909107371 1:71429610-71429632 AATGAGGTATGGATGGATCTAGG - Intronic
913570523 1:120115341-120115363 AATTAGGAGCACCTGGACCTGGG + Intergenic
915520817 1:156442047-156442069 AATTACGAACAAACTGATCTTGG + Intergenic
915620816 1:157082868-157082890 AATTGGGAAGGGATGGATATTGG + Intergenic
917071077 1:171151658-171151680 AACTAGTAAGAGATGGAGCTAGG + Intronic
918877291 1:190064174-190064196 GATTAGTAACAGATGGATCGGGG + Intergenic
921353358 1:214260882-214260904 AATTAGGAAAATATGAATATGGG - Intergenic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
1065785934 10:29214717-29214739 AATTGGGAACAGATGATTCTTGG - Intergenic
1067716886 10:48696949-48696971 GGTTAGGAAGAGATGGAGCTGGG + Intronic
1068920423 10:62477694-62477716 AATTAGGAAAACATACATCTGGG - Intronic
1069483098 10:68801865-68801887 GATAAGTAACAGATGGATTTGGG - Intergenic
1069586017 10:69602869-69602891 AATTTGGGACAGATGCATCAGGG + Intergenic
1070278171 10:75028258-75028280 TATTGGGAACACATGGATATAGG - Intronic
1071576267 10:86729027-86729049 AATTAGTAAGAGAAAGATCTGGG + Intronic
1074010234 10:109471158-109471180 ATTTCAGAACAGATGGATGTAGG - Intergenic
1074186390 10:111102582-111102604 GATTAGGAACAGAAGGAACTGGG - Intergenic
1078012171 11:7580886-7580908 AAAGAGGAACAGATGGAACCAGG + Intronic
1079310147 11:19358158-19358180 AATTAGAAAGAGAGGGATGTGGG + Intronic
1084760225 11:71266172-71266194 AATCAGCAACAGATGGATGACGG - Intergenic
1086179622 11:83934946-83934968 AATTACAAAAAGATGGATTTGGG + Intronic
1086484840 11:87287924-87287946 ATTTAGGAACAGATTGAACAGGG - Intronic
1089305212 11:117522153-117522175 AATTAGGCACAGAATGCTCTAGG - Intronic
1089592973 11:119556582-119556604 AATTAGGAAGAGATGGCTGGTGG + Intergenic
1090188912 11:124755624-124755646 AGTTAGCAACTGTTGGATCTAGG - Intronic
1091339526 11:134799497-134799519 AAGTAGGAACAGATCGATGAGGG - Intergenic
1091549395 12:1526665-1526687 AATTTGGGACAGCTGGATCGGGG - Intergenic
1092003002 12:5046338-5046360 AATTTGGAACACATGGATGGAGG - Exonic
1093727843 12:22535477-22535499 AAGAAGGTACAGATGGATCCAGG + Intronic
1094023237 12:25936294-25936316 AATTTGGAGCAGCTCGATCTGGG + Intergenic
1094787478 12:33865270-33865292 ATTTAGGCACAGATGGAACTTGG - Intergenic
1097641390 12:62186967-62186989 CATTAGAAACAGGTGGATTTTGG + Intronic
1101917213 12:108904879-108904901 AATTAAGAATAGAAGGATCATGG + Intergenic
1102737657 12:115177594-115177616 AATTTGGAACTGATGGAGCAAGG - Intergenic
1104303519 12:127588353-127588375 ACTTAGGTCCAGCTGGATCTTGG + Intergenic
1104551604 12:129762114-129762136 CATCAGGAACAGATTGATCCAGG - Intronic
1104919334 12:132282505-132282527 TTTTGGGAACAGCTGGATCTAGG + Intronic
1106778521 13:33032242-33032264 TAATGGGAACAGATGTATCTGGG - Intronic
1106906245 13:34412633-34412655 ACCAAGGAACAGAGGGATCTGGG + Intergenic
1107833466 13:44395024-44395046 AGTTAGGATCAGATGGAATTGGG - Intronic
1109731112 13:66415347-66415369 TTTCAGGAACAGATGGATTTTGG - Intronic
1110277103 13:73652833-73652855 TATTAGGAACAGATAGATATTGG + Intergenic
1110382819 13:74874008-74874030 AATGTGGAACAGATGCAACTGGG + Intergenic
1111192450 13:84827164-84827186 AATTGGGAATAAATGTATCTAGG + Intergenic
1111772609 13:92617511-92617533 ATTTAGTTACAGATGGAACTAGG - Intronic
1113180954 13:107625620-107625642 CATTAGGATCAAATGGATATTGG - Intronic
1115338580 14:32268174-32268196 AATGAGAAACACATGGTTCTAGG + Intergenic
1116277803 14:42859388-42859410 CATTAGAAACCCATGGATCTTGG - Intergenic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1124970158 15:34480946-34480968 AATTAAGAAAGGATGGATCTTGG + Intergenic
1126062693 15:44799106-44799128 GATTAGAAACAGCTGAATCTAGG + Intergenic
1126726792 15:51639947-51639969 AATTAGCAAGTGATAGATCTAGG - Intergenic
1130901049 15:88207002-88207024 AAGGAGGAACAGAAGGTTCTGGG - Intronic
1131721865 15:95178206-95178228 AATGGGGAACAAATGGATATTGG - Intergenic
1132189192 15:99835048-99835070 AATTAAGAAAGGATGGATCTTGG - Intergenic
1132842577 16:1985309-1985331 AGTGAGGAAGAGATGGCTCTTGG - Intronic
1134396803 16:13872631-13872653 ATTCAGGAACAGCTGGATCCAGG - Intergenic
1134597290 16:15506031-15506053 CATTGGGATCAGATAGATCTGGG + Intronic
1134639153 16:15815269-15815291 AATTAGGAAAATATGTATCTTGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1141771082 16:86089994-86090016 AGCTAGGAAGAGATGGAGCTGGG + Intergenic
1141903528 16:87007946-87007968 AATTAGGAACAAAAAGAACTGGG + Intergenic
1143226155 17:5305602-5305624 AAATAAGAACAGAGGGATTTTGG + Intronic
1143849257 17:9797440-9797462 AATTAGAAACAGATGGATCCTGG + Intronic
1144098364 17:11921906-11921928 TATTAGCAACAGAAGGATATGGG - Intronic
1146360929 17:32177389-32177411 TATTAGGAACATATGGGTATTGG - Intronic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1148335106 17:46835755-46835777 AATGAGGAACAGATCCAGCTGGG + Intronic
1148835337 17:50463025-50463047 TATACTGAACAGATGGATCTGGG + Intronic
1150261782 17:63798959-63798981 GATTAGAAACAGATGGTTGTGGG + Intronic
1153937805 18:9946080-9946102 AATTAGAAAAAGAGGGAACTAGG - Intronic
1155106894 18:22675884-22675906 AAATAGGTTAAGATGGATCTTGG - Intergenic
1155797024 18:30052332-30052354 AGTTATGAACAAATGGATCTAGG + Intergenic
1156248958 18:35332424-35332446 CTTTAGGCACAGCTGGATCTAGG + Exonic
1156406450 18:36787093-36787115 AAATAGGAATACATGGGTCTTGG + Intronic
1157352869 18:46905978-46906000 AAAAAGGAACAGATAGATCAGGG + Intronic
1157634361 18:49135598-49135620 TATTAGGTACAGATGTATTTAGG + Intronic
1159084047 18:63767411-63767433 AAATATCAACAGATTGATCTGGG - Intronic
1159302055 18:66586438-66586460 AAATAGGAACACATGGCTCTGGG + Intronic
1167536184 19:50053334-50053356 CTTCAGGAACAGATGGATCCAGG - Intronic
1167536778 19:50058605-50058627 CTTCAGGAACAGATGGATCCAGG - Intergenic
1167633258 19:50638930-50638952 AATTAGGAACAGACAGACCAGGG + Intronic
1167702474 19:51058182-51058204 CTTTAGGCACAGATGGATCCAGG - Intronic
1168614330 19:57825662-57825684 ATTTAGGAAATGATGGAGCTTGG + Intronic
1168624299 19:57904672-57904694 ATTTAGGAAGTGATGGAGCTTGG - Intronic
926307577 2:11649762-11649784 CCTTAAGAACAGTTGGATCTAGG + Intergenic
931738636 2:65221730-65221752 AATTAGGAAAAACTGGATATGGG + Intergenic
932444696 2:71771094-71771116 AAAGAGGAGCAGATGGATCAAGG - Intergenic
932952474 2:76310257-76310279 AATTAGGAATAGATGCATACTGG - Intergenic
933705645 2:85287859-85287881 AAATAGAAAGAGGTGGATCTGGG - Intronic
934567643 2:95349409-95349431 TGTTAGGAACTAATGGATCTGGG + Intronic
940263516 2:151811106-151811128 AAATAGGAAAAGGTGCATCTTGG + Intronic
940934976 2:159482897-159482919 ATCTAGGAATAGATGGTTCTTGG - Intronic
941168980 2:162114962-162114984 ACTTAGGAACAGCTGAATTTGGG + Intergenic
941191432 2:162388201-162388223 AATAAAGAAAAGATGGATATTGG + Intronic
943036429 2:182751538-182751560 AATTATGAACAAATTGATTTTGG - Intronic
943132604 2:183873326-183873348 AAATTGGAACAGAAGGATGTGGG - Intergenic
943213598 2:185001506-185001528 AATGAGGAACAAATGGGTGTGGG - Intergenic
946285040 2:218696596-218696618 ACTGAGGTACAGATGGATCTTGG + Exonic
946965343 2:225031304-225031326 ATTTCTGAACAGATGTATCTTGG - Intronic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
1169924311 20:10766819-10766841 AAATAGGAACAGATGAATCCAGG + Intergenic
1173010742 20:39179355-39179377 AATGAGGAACAGAGGAATCCAGG + Intergenic
1174731139 20:52918781-52918803 AATTAGGCATAGCTGGATCCAGG - Intergenic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1175841281 20:62029212-62029234 ACTTAGGAATTAATGGATCTAGG + Intronic
1177067715 21:16461879-16461901 ATTTAAGAGCAGATGAATCTGGG + Intergenic
1177804269 21:25858415-25858437 AACAAGAAACAGATGGACCTAGG - Intergenic
1182901547 22:33902645-33902667 AATTAGTAACAGATTCACCTAGG - Intronic
1183218830 22:36498673-36498695 ACTTAGAGACAGATGGATTTAGG - Intronic
1184301137 22:43561704-43561726 AGAGAGGAACAGATGGCTCTTGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950242450 3:11383840-11383862 AAATAGGAACTGAAGGTTCTAGG - Intronic
951485860 3:23209306-23209328 CATTAGCAACAGGTGCATCTTGG + Intronic
951891589 3:27572752-27572774 AAATAGATACAGCTGGATCTAGG - Intergenic
952525267 3:34203484-34203506 GATTAGAAACAGCTGAATCTAGG - Intergenic
953645465 3:44749654-44749676 AATGAGAAACACATGGTTCTAGG + Exonic
954902990 3:54035729-54035751 CAAGAGGAACAGCTGGATCTGGG + Intergenic
956756670 3:72394814-72394836 TTTTAGGAACAGATGTTTCTTGG + Intronic
959200358 3:103238178-103238200 AATGAGGAACAAACAGATCTGGG + Intergenic
961313715 3:126020090-126020112 AATTAGCACCACATGGACCTAGG + Intronic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
972181963 4:36478069-36478091 AATCAAGAACAAATGGATTTAGG - Intergenic
972539185 4:40024334-40024356 AAAAAGGAAAAAATGGATCTAGG + Intergenic
973205183 4:47551816-47551838 AATAAGGAAGATTTGGATCTTGG + Intronic
973321418 4:48814164-48814186 AAAGAGGGACAGATGGTTCTCGG + Intronic
973582304 4:52356494-52356516 AATTAAGAACATATGAATCTAGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
977405029 4:96587118-96587140 CATAAGGTACAGAAGGATCTAGG - Intergenic
979303931 4:119120502-119120524 AAATAGGAACAGATATATTTTGG + Intergenic
982360917 4:154518205-154518227 AAACAGGGACAGATTGATCTGGG - Intergenic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
983953416 4:173669297-173669319 AATTACGAACAGTGTGATCTTGG - Intergenic
986798301 5:11233636-11233658 AATTACTAACAGTTTGATCTTGG + Intronic
987197846 5:15545213-15545235 AATTGGTACCAGATAGATCTGGG - Intronic
987369079 5:17176643-17176665 ATTAAGGAGAAGATGGATCTGGG + Intronic
988387813 5:30589500-30589522 AACAAAGAACAGATGAATCTTGG - Intergenic
990660960 5:58014585-58014607 AAGTAGTAACAGAAGTATCTGGG - Intergenic
990915346 5:60897012-60897034 GATGAGGAACAGAAGGAACTAGG - Intronic
992363277 5:76064597-76064619 AATCAGGAAGAGATGGTTCCTGG + Intergenic
995713270 5:115055856-115055878 CTTTAGGAACAGATGAGTCTGGG + Intergenic
999955096 5:156691866-156691888 AATGAAGAACAGATGAAACTTGG - Intronic
1001238879 5:170052879-170052901 AACTAGGAAGTGATGGAGCTTGG + Intronic
1002988396 6:2214320-2214342 AATGAGGAACCGATGGATATAGG - Intronic
1004351932 6:14897784-14897806 ACTTAGGAGCATTTGGATCTGGG - Intergenic
1005313355 6:24580499-24580521 AATTAGAAACAGGTGGTTCTTGG - Intronic
1005604902 6:27466994-27467016 AATTTGGAAGAGATGGATTATGG - Intronic
1006820001 6:36885723-36885745 AATTAGGAAGACAAGGATTTAGG + Intronic
1007741310 6:44011286-44011308 AGTTAAGGACAGCTGGATCTGGG - Intergenic
1007984610 6:46195439-46195461 ATTTAGAATCAGATGGATATGGG + Intergenic
1008547595 6:52597089-52597111 AGCTAGCAACAGATGGAGCTAGG - Intergenic
1009988926 6:70817019-70817041 AAGTGGGAAGAGATGGAACTGGG - Intronic
1011178358 6:84589262-84589284 CATTAGTAAATGATGGATCTGGG + Intergenic
1011951405 6:92969858-92969880 AAGTAGGTCCAGATGGCTCTTGG - Intergenic
1014083974 6:117320382-117320404 AATTAGTAATAAATGCATCTGGG + Intronic
1014786074 6:125621061-125621083 AATTAGGCGCAGAAGGATTTAGG - Intergenic
1017480304 6:154846939-154846961 AACTAAGAACAGAAGGATTTGGG - Intronic
1018351006 6:162959257-162959279 AATTGTTAAAAGATGGATCTGGG + Intronic
1019295919 7:274871-274893 TTTTATGAACAGATGGATTTTGG - Intergenic
1020062088 7:5160257-5160279 AGTTTGGCACAGAAGGATCTTGG + Intergenic
1020166056 7:5808420-5808442 AGTTTGGCACAGAAGGATCTTGG - Intergenic
1023471582 7:40527812-40527834 CATTAGAAACATATGGTTCTGGG + Intronic
1025985873 7:66451337-66451359 AAGTTGGAACAAATGGAACTTGG + Intergenic
1027164722 7:75826223-75826245 AAAAAGGAACAGGTGGATCTGGG - Intergenic
1027743425 7:82041294-82041316 AGGTAGGGACAGATGGATCCAGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1033732013 7:144189306-144189328 AAATAGAAACTGATGGAACTGGG + Intronic
1033742862 7:144287889-144287911 AAATAGAAACTGATGGAACTGGG + Intergenic
1033751040 7:144361725-144361747 AAATAGAAACTGATGGAACTGGG - Intronic
1035589084 8:799365-799387 AATTAGGAGCAGCAGGATCCTGG + Intergenic
1036706977 8:11053407-11053429 AATTAGCACCAGAAGGACCTGGG - Intronic
1038087464 8:24215731-24215753 AAGTATGAAAAGATGGATTTAGG + Intergenic
1038342252 8:26696419-26696441 TGTCAGGAGCAGATGGATCTTGG - Intergenic
1038864472 8:31424539-31424561 GATCAGGAACAGATAAATCTGGG - Intergenic
1040039309 8:42900101-42900123 AATTTGGAACATATGGTTCTTGG - Intronic
1041140259 8:54810603-54810625 AAAAAGGAACACATGGACCTTGG - Intergenic
1041286610 8:56268967-56268989 AACTAGTAACAGAGGGATTTGGG - Intergenic
1042185407 8:66131830-66131852 AATTAGGAACATCTGGATGAAGG - Intronic
1042950714 8:74198457-74198479 CATTAGGAGCAGATGGGACTGGG + Intergenic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1043602514 8:81957884-81957906 AAGTAGGAAGAGAAGGAGCTGGG - Intergenic
1044360714 8:91280492-91280514 AAGGAGGAGCAAATGGATCTTGG - Intronic
1046928283 8:119816596-119816618 AATAAGTAACAGAAGCATCTAGG + Intronic
1047084049 8:121496679-121496701 AAATAGGAACACATGGATACAGG + Intergenic
1049233401 8:141495862-141495884 ATTTATGAATAGATGGATGTTGG - Intergenic
1049659474 8:143813333-143813355 AAGCTGGAACAGCTGGATCTGGG - Exonic
1049933752 9:480914-480936 AATTTGGTACAGATGCTTCTTGG + Intronic
1050581787 9:7065418-7065440 TATAAGCAACAGATGGCTCTAGG - Intronic
1050656182 9:7831257-7831279 AATTAGGAAGAAATGGATGGTGG - Intronic
1050835139 9:10067939-10067961 AGTTGGGAAGAGATGGCTCTTGG + Intronic
1051429171 9:16964532-16964554 AATTAAAAACAGCTGCATCTAGG + Intergenic
1052764544 9:32627402-32627424 TATTAGGAACTGATGATTCTTGG + Intergenic
1054949867 9:70837911-70837933 CATTAGAGACAGTTGGATCTTGG + Intronic
1056977819 9:91276136-91276158 AATTAGGAACAGGTCGAGCGCGG + Intronic
1057414369 9:94848146-94848168 AATAAGTAAAACATGGATCTTGG + Intronic
1057715408 9:97491277-97491299 ATTTAAGAACAGATGGATAATGG - Intronic
1058078570 9:100676228-100676250 ACAAATGAACAGATGGATCTGGG + Intergenic
1058365094 9:104200257-104200279 AACTAGCAACAGAAAGATCTGGG - Intergenic
1059623841 9:116039691-116039713 AACTAGGGACAGGTGGGTCTGGG - Intergenic
1060637377 9:125210106-125210128 AATAAGAAACAATTGGATCTGGG + Intronic
1062207510 9:135345329-135345351 GGTTAGGAACAGACGGATCAGGG + Exonic
1185728002 X:2438211-2438233 TTTTAGGAACAGAATGATCTAGG + Intronic
1188324412 X:28783256-28783278 AATAAGGCACAGATGCATTTTGG + Intronic
1188434640 X:30147214-30147236 TATTAGTAGCAGCTGGATCTTGG + Intergenic
1188438370 X:30189111-30189133 AATTAGGAACAAATTGCTATGGG - Intergenic
1188543821 X:31279608-31279630 ATCTAGGAACAGATGCAACTAGG - Intronic
1189219878 X:39362338-39362360 AATTTGGGATAGATGGATGTTGG + Intergenic
1189351190 X:40277045-40277067 AAGGAGGAAGAGATGAATCTAGG + Intergenic
1192938390 X:75885602-75885624 AATTATGAACAGATACATATTGG + Intergenic
1198817070 X:140602939-140602961 AAATAGGAACAGAGGGAACTTGG - Intergenic
1198926068 X:141797485-141797507 AACTTGGAACAGATAAATCTGGG + Intergenic
1201020488 Y:9651489-9651511 AATTTGGAACACTTGTATCTTGG - Intergenic