ID: 975183455

View in Genome Browser
Species Human (GRCh38)
Location 4:71373774-71373796
Sequence TAGGATTGCGACTGTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975183452_975183455 2 Left 975183452 4:71373749-71373771 CCAGTGCTGGAAAAAGGATTTAA 0: 1
1: 0
2: 2
3: 28
4: 226
Right 975183455 4:71373774-71373796 TAGGATTGCGACTGTGGAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975183455 Original CRISPR TAGGATTGCGACTGTGGAAG TGG Intronic
901238100 1:7678354-7678376 CAGGATCACGACTGTGGCAGAGG + Intronic
902580439 1:17404412-17404434 AAGGATGGCGAATGGGGAAGGGG - Intergenic
912872734 1:113324695-113324717 TAGGTTTGGGGTTGTGGAAGGGG + Intergenic
915690193 1:157681089-157681111 TAGGACTGTGACTGTGACAGAGG + Exonic
924174110 1:241372250-241372272 TGGGATAGTGAGTGTGGAAGAGG + Intergenic
924805145 1:247355975-247355997 CATGATTTCCACTGTGGAAGAGG + Intergenic
1064810409 10:19191404-19191426 TGGCATAGCTACTGTGGAAGAGG + Intronic
1072468169 10:95686805-95686827 TTGGCTTGCGAGGGTGGAAGGGG - Intronic
1073047120 10:100646115-100646137 TAGGACTGGGACTGAGGGAGGGG + Intergenic
1074210894 10:111334012-111334034 TAGGATGGCCACTGTGGAGATGG + Intergenic
1076182949 10:128424853-128424875 GAGGATTGTGACTGTGGCTGGGG - Intergenic
1078663826 11:13308058-13308080 TAGGATGGGGACGGTGGAGGTGG + Intronic
1079586342 11:22130084-22130106 TAGGATAGGGGCTGTGGCAGTGG - Intergenic
1081962923 11:47151488-47151510 TAGGATGGTGGCTGTGGACGTGG + Intronic
1083231574 11:61324493-61324515 TAGCATTGCCACAGTGGTAGGGG - Intronic
1086849625 11:91794145-91794167 TAGGAGTGGGATTGTGCAAGTGG + Intergenic
1088394388 11:109350501-109350523 AAGGGTTTAGACTGTGGAAGCGG + Intergenic
1089114812 11:116086149-116086171 TGGGATAGGGCCTGTGGAAGTGG + Intergenic
1092973808 12:13724739-13724761 TAGGAGAGTGAATGTGGAAGGGG - Intronic
1094510605 12:31094148-31094170 TTGGAAGGCGTCTGTGGAAGTGG + Intronic
1097051395 12:56225212-56225234 AAGGGTTGGGATTGTGGAAGGGG - Intronic
1100469717 12:94879610-94879632 TAGGATGGTGATTGTGGAAATGG + Intergenic
1101902164 12:108798867-108798889 CAGGATTTTGGCTGTGGAAGCGG + Intronic
1104509971 12:129368357-129368379 AAGGATGGAGAATGTGGAAGGGG - Intronic
1106222590 13:27758892-27758914 AAGGATGGGGAGTGTGGAAGAGG - Intergenic
1114158655 14:20136880-20136902 GAGAATGGAGACTGTGGAAGAGG - Intergenic
1117644894 14:57841405-57841427 TAAAATAGCGATTGTGGAAGTGG + Intronic
1119290168 14:73489380-73489402 TAGGCTTGCAACTGAGAAAGAGG + Intronic
1124087906 15:26568875-26568897 TAGGATTGGAACTGAGAAAGTGG - Intronic
1124411414 15:29440710-29440732 GAGGATGGTGACAGTGGAAGAGG - Intronic
1135435392 16:22423471-22423493 TAGGAGCGGGACTGAGGAAGGGG - Intronic
1137593906 16:49711038-49711060 TAGGGTGACGACTGTGGAACGGG + Intronic
1139423307 16:66862586-66862608 TGGGCTTGCAACTGTGGAAACGG + Intronic
1141337508 16:83170927-83170949 GAGGATAGCGACGATGGAAGAGG - Intronic
1142044589 16:87917280-87917302 TAGGAGCGGGACTGAGGAAGAGG - Intronic
1145057741 17:19714420-19714442 TAGGATTGAGGCTGGGGAACCGG + Intronic
1147865433 17:43548954-43548976 GAGGATTGGGAATGTGGAGGGGG - Intronic
1155304482 18:24465458-24465480 TAGGAGTGGGACTGCGGAGGTGG + Intronic
1156028770 18:32688825-32688847 TAGGAGGGCCACTGTGGAAGAGG + Intronic
1159242981 18:65767047-65767069 TAGGGAAGCAACTGTGGAAGAGG - Intronic
1160804868 19:988219-988241 GAGGATTTCGACCGTGGCAGGGG - Intronic
1164782122 19:30901234-30901256 TAGGATTGTGAGTGTCGAAGGGG + Intergenic
1167670842 19:50852405-50852427 TGGGATTGACACTGTGGAGGTGG + Intergenic
925425079 2:3742721-3742743 TATGATTGCGACAGTGGATGAGG + Intronic
928315562 2:30242150-30242172 TAGCATAGAGACTGTGGAATAGG + Intronic
933486118 2:82926156-82926178 TTGGAATGAGGCTGTGGAAGTGG + Intergenic
934920081 2:98335967-98335989 CAGGATTGGGGTTGTGGAAGAGG + Intronic
947091258 2:226513501-226513523 TAGGATTACAGTTGTGGAAGTGG - Intergenic
1171277162 20:23867301-23867323 TAGGACTGAGAATGAGGAAGCGG - Intergenic
1172807148 20:37620504-37620526 TAAGAGTGCGAGAGTGGAAGCGG + Intergenic
1178147602 21:29757827-29757849 TAAGATTACAACTGAGGAAGGGG - Intronic
1180451925 22:15471521-15471543 TTGGATTGCGAAGGAGGAAGTGG + Intergenic
1180782641 22:18529531-18529553 TAGGCTTTCGAGTGTGGATGGGG + Intronic
1181126198 22:20703558-20703580 TAGGCTTTCGAGTGTGGATGGGG + Intergenic
1181239531 22:21468869-21468891 TAGGCTTTCGAGTGTGGATGGGG + Intergenic
1181319111 22:21991049-21991071 CAGGCTTTCGACTGGGGAAGGGG + Intergenic
1183661493 22:39224139-39224161 TAGGAGGGAGACTGTGGTAGGGG - Exonic
951582002 3:24174529-24174551 TAGGATTGGGGTTGTGGGAGGGG - Intronic
955502572 3:59599626-59599648 TAGAATGGCTCCTGTGGAAGGGG - Intergenic
958684365 3:97374213-97374235 TAGGATAGCAACTGTGGATGTGG - Intronic
959520256 3:107316876-107316898 TAGAATTGTTACTGTGGCAGTGG + Intergenic
963901864 3:150740749-150740771 TAGGGTTGGGACTGAGGGAGTGG + Intergenic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
971239122 4:24871704-24871726 TAGGATTGAGAGTGTGGTGGTGG - Intronic
972095909 4:35346781-35346803 TAGCATTGAGACATTGGAAGGGG - Intergenic
973181305 4:47271715-47271737 CAGGAGTGGGACAGTGGAAGTGG + Intronic
975183455 4:71373774-71373796 TAGGATTGCGACTGTGGAAGTGG + Intronic
975298160 4:72757920-72757942 TAGGATTGTGAGTGATGAAGGGG + Intergenic
977600453 4:98929094-98929116 TAAGATGGCGACTGTCGAACCGG - Exonic
984742545 4:183179661-183179683 GAGGAATGGGACTGGGGAAGTGG + Intronic
989154526 5:38331559-38331581 GAGGATTGAGACTATGGATGAGG + Intronic
990125045 5:52505413-52505435 TAGGATTTGGTCTGTGAAAGTGG - Intergenic
993027412 5:82662773-82662795 TAGGAGTTGGACAGTGGAAGGGG + Intergenic
998503190 5:142651408-142651430 TAGGGGTGGGACTGGGGAAGAGG - Intronic
1002387010 5:178875828-178875850 TAGGACTGCTGCTGTGGCAGTGG + Intronic
1007326703 6:41067161-41067183 TTGGATTATGACTGTGGAGGAGG - Exonic
1009323778 6:62324262-62324284 TAGAAATGCATCTGTGGAAGTGG - Intergenic
1010024415 6:71199119-71199141 TAGGTGTGTGAATGTGGAAGGGG + Intergenic
1012366256 6:98444247-98444269 TAGGTTGGCAACTGTGGAGGAGG - Intergenic
1013718337 6:112990916-112990938 TAGGATTTGGGCTATGGAAGTGG + Intergenic
1016271270 6:142293177-142293199 TAGGATTGTTACTGTGACAGGGG + Intergenic
1020761057 7:12269080-12269102 TAAGATTGAGGCTGTGGCAGAGG - Intergenic
1025250164 7:57346556-57346578 TAGGAATGGGACTGGGGAGGTGG + Intergenic
1026211880 7:68313062-68313084 CAGGATTTCCACTGTAGAAGAGG + Intergenic
1027438863 7:78196686-78196708 TGGGACTGGGACTGTGGCAGGGG + Intronic
1028241257 7:88423848-88423870 AAGGATGGTCACTGTGGAAGTGG + Intergenic
1029657368 7:101936169-101936191 GAGGATTCTGACTGTGGAACTGG + Intronic
1032432626 7:131874190-131874212 TAGGAATGAGACTGAGGCAGAGG + Intergenic
1041959339 8:63594582-63594604 TAGGATGGCAAGGGTGGAAGCGG + Intergenic
1047733595 8:127746753-127746775 TAGCACTGGGATTGTGGAAGAGG - Intergenic
1048387224 8:133923038-133923060 TAGCATTGATACTCTGGAAGAGG + Intergenic
1051726191 9:20089703-20089725 TAGAACTGCTACTGTGGCAGTGG - Intergenic
1055885550 9:81059442-81059464 TAAGATTGGGAGTGAGGAAGAGG - Intergenic
1192452299 X:71252090-71252112 TAGGATTGCGTCTCTGATAGGGG - Intronic
1195095138 X:101494178-101494200 TAGGCTTGGGGCTGGGGAAGAGG + Exonic
1200323326 X:155212691-155212713 TAGGCTTGCCACTGTGTAATAGG - Intronic