ID: 975185384

View in Genome Browser
Species Human (GRCh38)
Location 4:71396265-71396287
Sequence CTTGATGAAATGCAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975185381_975185384 13 Left 975185381 4:71396229-71396251 CCAGGTAAAAGATTTAAGAGATC 0: 1
1: 0
2: 0
3: 13
4: 147
Right 975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG 0: 1
1: 0
2: 3
3: 14
4: 246
975185380_975185384 17 Left 975185380 4:71396225-71396247 CCAACCAGGTAAAAGATTTAAGA 0: 1
1: 0
2: 0
3: 19
4: 191
Right 975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG 0: 1
1: 0
2: 3
3: 14
4: 246
975185379_975185384 18 Left 975185379 4:71396224-71396246 CCCAACCAGGTAAAAGATTTAAG 0: 1
1: 0
2: 1
3: 16
4: 189
Right 975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG 0: 1
1: 0
2: 3
3: 14
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975185384 Original CRISPR CTTGATGAAATGCAGCAGAG TGG Intronic
904826968 1:33280283-33280305 CTTGATGGAGTCCAGGAGAGGGG - Exonic
907640745 1:56187878-56187900 CTTTATGAAATGTAGTATAGTGG + Intergenic
907643214 1:56213680-56213702 CTCTATGAGATGCAGCAGTGTGG - Intergenic
907795557 1:57713043-57713065 CATGATGAAATGCAGATTAGAGG - Intronic
908131126 1:61076699-61076721 CTTGATTTAATGCACCAAAGAGG + Intronic
908690740 1:66776784-66776806 CTTGATGAAGTGCAGCCCTGGGG - Intronic
910373033 1:86538468-86538490 CTTCAAGGAATGCAGCATAGGGG + Intergenic
910648214 1:89536187-89536209 CCTGATGACCTGCAGTAGAGGGG + Intronic
911731650 1:101297604-101297626 GCAGAGGAAATGCAGCAGAGGGG + Intergenic
911834669 1:102601646-102601668 CTTTCTGAAATGTTGCAGAGAGG + Intergenic
912141988 1:106741391-106741413 CTTAATAAAAAGCAGCAGAAAGG + Intergenic
916765871 1:167860064-167860086 TTTCATGAACTGCGGCAGAGGGG + Intronic
916870497 1:168909351-168909373 CTTGAGGATACGAAGCAGAGTGG + Intergenic
918386611 1:184014354-184014376 CATGATTGAATGCAGCAGAAAGG + Intronic
918826893 1:189336398-189336420 TTTGATGAGCTCCAGCAGAGTGG + Intergenic
919147048 1:193649108-193649130 TTTGATGAAATTCAGCAATGAGG + Intergenic
921120108 1:212128707-212128729 AATGATGAAATGCACAAGAGAGG - Intergenic
922718302 1:227887962-227887984 TTTAATAAAATGCATCAGAGCGG + Intergenic
924208616 1:241742237-241742259 CTGGAGGAAATGCAGCAGAAAGG - Intronic
1063475400 10:6324173-6324195 CTTGATGACATGACGCTGAGTGG + Intergenic
1064470385 10:15629412-15629434 ATAGATGAAATGGGGCAGAGGGG - Intronic
1064523639 10:16230065-16230087 CTTTTTGAAGTGCAGCAGTGTGG + Intergenic
1065838907 10:29683834-29683856 CATGGTGAAGTGCAGCACAGAGG - Intronic
1069247638 10:66226716-66226738 ATTGATGAAATACATTAGAGTGG - Intronic
1070690283 10:78519541-78519563 ACTGCTAAAATGCAGCAGAGTGG + Intergenic
1070757824 10:79004460-79004482 CTTGATGACAGACAGCACAGTGG - Intergenic
1072132730 10:92512073-92512095 CTTGATGATATGAAGGTGAGTGG - Intronic
1072617128 10:97057282-97057304 CTGGAGAAAAGGCAGCAGAGAGG + Intronic
1072620478 10:97076011-97076033 CTTGGTGAGCTGCAGCTGAGGGG - Intronic
1073841242 10:107501565-107501587 CTTGACAAAATGCATCAGTGAGG + Intergenic
1075525414 10:123180984-123181006 TTTGCAGAAATGTAGCAGAGGGG + Intergenic
1080331830 11:31148031-31148053 GTGGAAGAAATGCAGTAGAGAGG + Intronic
1080334386 11:31179683-31179705 TTTGATGGAATTCAGCAGTGAGG - Intronic
1081168475 11:39836231-39836253 CTACATGAAATGCTGCAGGGGGG + Intergenic
1081264601 11:41004725-41004747 CTTGACAAAATAAAGCAGAGGGG + Intronic
1086392714 11:86381889-86381911 GTAGATGAAATGGATCAGAGAGG + Intronic
1086549351 11:88037287-88037309 CAAAATGAAATGCTGCAGAGGGG - Intergenic
1086893077 11:92281484-92281506 CCTGCGGAAATGCAGAAGAGAGG - Intergenic
1087235450 11:95713001-95713023 GATGAGGAAATGGAGCAGAGAGG - Intergenic
1087747839 11:101970279-101970301 ATTGCTGAAAAGCAGCAGTGTGG + Intronic
1088575322 11:111265971-111265993 CTTAATGAAATGCACCAGGTTGG - Intronic
1089144282 11:116313093-116313115 GCTGAGGAAATGCCGCAGAGAGG + Intergenic
1089309373 11:117547661-117547683 CTTGCTAAACGGCAGCAGAGCGG - Intronic
1090605491 11:128419344-128419366 GTCAATGAAATGCTGCAGAGTGG - Intergenic
1091352465 11:134908029-134908051 CTTGGTGGGATGCAGCAGAGGGG - Intergenic
1092104418 12:5911268-5911290 CTACATGAAAAGCAGGAGAGAGG + Intronic
1092953238 12:13526867-13526889 CTGTAGAAAATGCAGCAGAGGGG + Intergenic
1093392352 12:18637828-18637850 CTTGATTTAATGTAGCAGAAAGG - Intronic
1094826911 12:34276495-34276517 GTTGATGGAATCCAGCATAGAGG - Intergenic
1096194428 12:49640750-49640772 CCTCTTGAAATGCAGCAGAAAGG - Exonic
1096579365 12:52574543-52574565 CTGGAGGAAATGCAGCTGACTGG - Intergenic
1096982789 12:55737965-55737987 CTCGTTGAGATGTAGCAGAGGGG - Intergenic
1098894111 12:76038056-76038078 CTGGATGAAATGGAGCAGAGAGG + Exonic
1101846370 12:108366360-108366382 CTTCACGAAAAGCAGCAGAAAGG + Intergenic
1101941782 12:109104663-109104685 CTTGATGGAGAGCCGCAGAGTGG + Intronic
1103627532 12:122231523-122231545 CTTGAAGAAATACAGCACTGGGG + Exonic
1104115007 12:125741237-125741259 CTTGAAAAAATGCAACAGAATGG - Intergenic
1104339405 12:127933810-127933832 CTTCAAGAAATGTAGAAGAGAGG - Intergenic
1106485275 13:30166915-30166937 CTTGCTGAGATGCGGCAGAGTGG - Intergenic
1107200361 13:37708300-37708322 CTAGATGAAATGAAGCAGATAGG - Intronic
1107405127 13:40105210-40105232 AGTCATGAAATGCAGAAGAGAGG - Intergenic
1107614708 13:42153637-42153659 GCTCATGAGATGCAGCAGAGAGG - Intronic
1111088748 13:83413820-83413842 CTTTATGAAATGATGAAGAGAGG - Intergenic
1111404681 13:87787985-87788007 ATAAATGAAATGAAGCAGAGGGG - Intergenic
1111727829 13:92034930-92034952 CTTGATGGAATTCAGCTAAGTGG - Intronic
1112466241 13:99647273-99647295 CTTGTTCATAGGCAGCAGAGAGG + Intronic
1113021153 13:105888954-105888976 CTGGATAAAATCCCGCAGAGTGG + Intergenic
1113977632 13:114241405-114241427 CTGGCAGCAATGCAGCAGAGTGG - Intronic
1115904274 14:38189659-38189681 CTTGGTGGAAACCAGCAGAGAGG - Intergenic
1117035643 14:51725437-51725459 CTTTATGAGATGCAGTAAAGAGG + Intronic
1117713347 14:58555399-58555421 CTTGATGAAAAGCTACAGATGGG - Intergenic
1119662608 14:76462624-76462646 CTTCATGAAATGCCTCAAAGTGG + Exonic
1121744106 14:96274538-96274560 CTTTATGAAATGAAGGAGGGAGG + Intergenic
1122116795 14:99531690-99531712 GTTGGTGAAAAGCAGGAGAGAGG - Intronic
1123786004 15:23674322-23674344 TTTGATGAAATGGAGAAGGGAGG - Intergenic
1124958345 15:34375021-34375043 CATGATGAGATGCAGGAGATGGG + Intergenic
1125639325 15:41216681-41216703 CTTGAGGTCATTCAGCAGAGAGG + Exonic
1126257289 15:46642867-46642889 GTTGATGAAATCAAGAAGAGGGG - Intergenic
1126400692 15:48266600-48266622 CTTGATAAAATGCAGCCTTGTGG - Intronic
1127742508 15:61925761-61925783 CATGATGAAATTCATCAGAACGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129690592 15:77711092-77711114 TTTAATGAAATGGATCAGAGAGG - Intronic
1133318580 16:4899109-4899131 GTTGATGAAATTCTGCAGTGGGG + Exonic
1134241211 16:12508367-12508389 CTCGATGAACTGTAGCAGCGGGG + Intronic
1135491827 16:22915983-22916005 CTTGAAGAAATGAAGCTCAGAGG - Exonic
1136279792 16:29201569-29201591 GATGAGGAAACGCAGCAGAGTGG - Intergenic
1137943311 16:52710017-52710039 CATGGTGAGATGGAGCAGAGAGG - Intergenic
1138726924 16:59150376-59150398 TATCATTAAATGCAGCAGAGAGG - Intergenic
1141816740 16:86415766-86415788 CTGGATGAAATGCTGCAAACGGG + Intergenic
1143708745 17:8718626-8718648 CTTCAAGAGATGCAGCTGAGAGG - Intergenic
1144247793 17:13384560-13384582 GTTGAGGAAATGCATAAGAGTGG - Intergenic
1145899519 17:28481119-28481141 CTGGATGTAATCCAGCAGCGAGG + Intronic
1146495049 17:33314198-33314220 CTTGCTGAAAGGCTGCAGGGAGG + Intronic
1146638753 17:34524900-34524922 CCTGAGGAAATGCAGAAGAAAGG + Intergenic
1147317193 17:39626709-39626731 ATTGATGGAGTCCAGCAGAGAGG - Intergenic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149636044 17:58170230-58170252 CTTGAGGAACTCCAGCAGTGAGG - Exonic
1149829426 17:59858527-59858549 CTTAACGAAATGCAGCAGCGGGG + Intergenic
1149972657 17:61234650-61234672 GTTGGTGAAATGCTGCACAGTGG - Intronic
1153719351 18:7885788-7885810 CATGCTGGAATGGAGCAGAGTGG + Intronic
1155271446 18:24145227-24145249 CTAGGTGAAATTCAGCAGAGAGG + Intronic
1156473331 18:37390920-37390942 CCTAATGGAATGGAGCAGAGGGG + Intronic
1156684388 18:39627219-39627241 CTAGATGTAAAGCTGCAGAGGGG + Intergenic
1156746857 18:40402833-40402855 CCTGAGGAAATGGAGCAGGGTGG + Intergenic
1156857489 18:41799242-41799264 CCTGCTGAAATGCAGGAAAGAGG - Intergenic
1158062448 18:53361988-53362010 CTTGAAGAAATGGGGCAGAAAGG + Intronic
1159218738 18:65431027-65431049 CTTGATGATTGGCAGCAGGGAGG + Intergenic
1159610408 18:70518710-70518732 TTTGAAGAAATGCAGAAGATGGG - Intergenic
1162543829 19:11315807-11315829 CTTGATAAACAGCAGCAAAGTGG - Intronic
1163457005 19:17412899-17412921 CAGGATGAAATTCAGCAGACTGG + Intronic
1164554300 19:29239007-29239029 CTTACTGAAAAGCTGCAGAGAGG - Intergenic
1164609085 19:29620248-29620270 CTGGGTGAAATGCAACAGACTGG + Intergenic
1167488817 19:49780241-49780263 CATGGTGAAATGTACCAGAGAGG + Intronic
924986424 2:274644-274666 CTGGAGGAAATAAAGCAGAGAGG - Intronic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
927344710 2:22024546-22024568 CTTGGTGAAATGGAGCAGCCAGG + Intergenic
927870033 2:26617606-26617628 GTTAATGAAAAGCAGCAGATTGG - Intronic
928337127 2:30407698-30407720 CTTGATGAATGACTGCAGAGTGG - Intergenic
928845087 2:35661832-35661854 CTGTATGAAATGGAGCAAAGTGG - Intergenic
929666560 2:43838458-43838480 AGTGAAGAAAGGCAGCAGAGGGG + Intronic
929746419 2:44664130-44664152 GTTTATTAAAAGCAGCAGAGTGG + Intronic
930195780 2:48508530-48508552 CTTGTTGGAATGCAGGAAAGGGG + Intronic
932337939 2:70941699-70941721 CTTGAAGAAAGGAAGCAGGGAGG + Exonic
936156768 2:110051968-110051990 CTTGATGCAGTGCAGCAGATGGG - Intergenic
936252260 2:110875961-110875983 CTTTATAAAATACAGTAGAGTGG - Intronic
938142357 2:128806250-128806272 CTTGATGAATTTCTGTAGAGTGG + Intergenic
938909632 2:135874976-135874998 CATAATGAAAGGAAGCAGAGTGG + Intronic
940700308 2:157032869-157032891 CTAGTTGAAATACAGCAGAAGGG - Intergenic
940984681 2:160040752-160040774 CTTGTTGACTTACAGCAGAGAGG + Intronic
943468124 2:188256252-188256274 CTTGTTAAATTACAGCAGAGAGG + Intergenic
944302066 2:198134807-198134829 CTTGCTGAAATCCAGCACTGTGG + Intronic
944410678 2:199439359-199439381 CTTGAAGGAAGGCAGCAGACAGG + Intronic
944961540 2:204880359-204880381 CAGTTTGAAATGCAGCAGAGTGG + Intronic
945973832 2:216255299-216255321 CTTGAGGAAATGTGACAGAGTGG + Intergenic
946714410 2:222538467-222538489 CTGTATAAAATGCAACAGAGAGG - Intronic
948559492 2:238842117-238842139 CTTCTTGAATTGCAGCAGATGGG - Intergenic
1170080258 20:12467383-12467405 CTTGAGGAACTGCAACAGAGTGG - Intergenic
1170298943 20:14860609-14860631 CTTGCTGAAAAGCATCAAAGGGG - Intronic
1172895232 20:38295547-38295569 CTTGGTGATGTGAAGCAGAGGGG + Intronic
1174315750 20:49699794-49699816 CAGGGTGAAATTCAGCAGAGTGG - Intronic
1175781646 20:61685956-61685978 TCTGATGAAAGGCAGGAGAGGGG - Intronic
1176754577 21:10716368-10716390 TTTAATGGAATGCACCAGAGTGG - Intergenic
1178674310 21:34617807-34617829 TTGGATGAAGTGCAGCAGAATGG + Intergenic
1178770892 21:35502989-35503011 CGTGAGTAAATGCAGCACAGGGG - Intronic
1181825827 22:25514826-25514848 CGTGGTGAAATGCCGCAGATGGG + Intergenic
1183026742 22:35071019-35071041 CTTGATGAACTGCAGCATGAGGG - Intronic
1183321129 22:37165874-37165896 CTTGAGGAGATGCTGTAGAGGGG - Intronic
950718046 3:14863613-14863635 CTTGTTGCTATGCAGCTGAGTGG + Intronic
950953287 3:17023989-17024011 GAGGATGAACTGCAGCAGAGAGG - Intronic
952672415 3:35986213-35986235 CTTGATGAAATGAAGAACAAAGG - Intergenic
952750813 3:36823429-36823451 CGTGATGAACTGAAGGAGAGAGG + Intergenic
953754688 3:45636154-45636176 CTGTGTGAAATGCAGCAAAGGGG + Exonic
953773098 3:45793773-45793795 CATTATGAAAGGCTGCAGAGGGG - Intronic
953885623 3:46712949-46712971 CTTGATGATCTGAACCAGAGTGG + Exonic
954238639 3:49276453-49276475 CTTGGAGAACTGCAGGAGAGGGG - Exonic
954925207 3:54227870-54227892 CTTCATGAAAGGGAGCAGGGAGG - Intronic
956191051 3:66608971-66608993 CATGAGGTAATGCAGCACAGAGG - Intergenic
957407120 3:79786124-79786146 CTTGTTGAAATTAAGCTGAGTGG + Intergenic
957581594 3:82079899-82079921 CTTCATGTAATTCAGCAAAGAGG - Intergenic
959654014 3:108780426-108780448 CCTGAGGAAATGGAGCAGAGAGG + Intergenic
963605492 3:147409320-147409342 CTTGATGAATGGGAGCAGGGGGG - Intronic
964066561 3:152587013-152587035 CTTGAGTTAATGCTGCAGAGAGG - Intergenic
964523599 3:157593543-157593565 TTGGATGAAACGCTGCAGAGTGG + Intronic
966318215 3:178672576-178672598 CTTATGGAAATGCAGCGGAGAGG + Intronic
967351549 3:188519260-188519282 CCTGATGGGATGCAGCAGAAGGG + Intronic
970264249 4:14263794-14263816 CTTGAAGACAAGCAGCATAGTGG - Intergenic
971871884 4:32251775-32251797 TTTGATCAAATGTAGCAGACAGG + Intergenic
972127157 4:35782836-35782858 ATTGGTGAAATACAGCAGACTGG - Intergenic
973604930 4:52577121-52577143 CTTTATGAGATGAAGCAGTGTGG - Intergenic
974589183 4:63921132-63921154 CTTCATGAAATGCACCATACTGG + Intergenic
975185384 4:71396265-71396287 CTTGATGAAATGCAGCAGAGTGG + Intronic
975630920 4:76401369-76401391 CATGATGACAGGAAGCAGAGTGG + Intronic
977363978 4:96043107-96043129 CTGGATGCAATATAGCAGAGTGG - Intergenic
977737122 4:100430328-100430350 CCTACTGAAATGCAGCAGATTGG - Intronic
978137197 4:105276395-105276417 CTTGATGAAACGCAGGTAAGTGG - Exonic
978377268 4:108087955-108087977 CTTGATTAAAGGAAGCAGGGTGG + Intronic
979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG + Intergenic
984591062 4:181618308-181618330 CTGAATGAAGTGCTGCAGAGCGG - Intergenic
984621853 4:181962391-181962413 CTTGATTGCATGCAACAGAGAGG - Intergenic
984710146 4:182878036-182878058 CTTGGTGAAAGTCAGCAGAAGGG - Intergenic
986344402 5:6821349-6821371 ATTGATGAAATGAAGTAGAATGG - Intergenic
988423426 5:31034339-31034361 CTTGATGAAATTTAGACGAGTGG - Intergenic
988727625 5:33939786-33939808 CTCTATGAAAGCCAGCAGAGGGG - Intergenic
989479042 5:41906965-41906987 CTTCATGAAGTGCTGCAGAAGGG + Intronic
989977642 5:50605708-50605730 CTTGCTGAACTGCAGCTCAGAGG - Intergenic
990828278 5:59926917-59926939 TTTGGTAAAATGCAGCAGTGAGG - Intronic
991982633 5:72249266-72249288 AATGATCAAATGCAGAAGAGAGG - Intronic
992676030 5:79107330-79107352 TTTGAGGAAAAGCAGAAGAGAGG + Intronic
993544692 5:89196810-89196832 CTTCATAAAATGAATCAGAGAGG + Intergenic
994988617 5:106969563-106969585 TTGGATCAAATGCAACAGAGTGG + Intergenic
996007631 5:118442109-118442131 CTTGATGTAGTGTAGCAGAGGGG - Intergenic
997823591 5:137087186-137087208 TCTGATGAACTGCAGCAGGGAGG + Intronic
997924713 5:138019017-138019039 CTTGATGAGCTGCAGCAGGGAGG - Exonic
1001936386 5:175708814-175708836 CTTGATGACAAGCACCAGAGAGG - Intergenic
1003843613 6:10148999-10149021 CTGCATTAAATCCAGCAGAGGGG - Intronic
1007212722 6:40208441-40208463 CTTGTTAACATGCAGCATAGTGG - Intergenic
1009372685 6:62926855-62926877 CTAGATGAAATGCAGCAGACTGG + Intergenic
1010183076 6:73110773-73110795 ATTCATGAAATGGAGGAGAGAGG - Intronic
1010398657 6:75423064-75423086 CTTGAAGAAAAGGAGCACAGTGG + Intronic
1011033419 6:82946492-82946514 CTTGAAGAAATGCTAAAGAGAGG + Intronic
1014112841 6:117638951-117638973 CTTGATGAAATGTAGAATGGAGG - Intergenic
1015119103 6:129681927-129681949 CTTGATGAGATACAGCAGAGAGG - Intronic
1015365905 6:132397838-132397860 CAGGATGTAATGCAACAGAGAGG - Intronic
1015453444 6:133397402-133397424 CTAGATGGAATGCAGCTGATTGG - Intronic
1016703835 6:147083832-147083854 CTAGAGCAAAGGCAGCAGAGAGG - Intergenic
1018884348 6:167920436-167920458 CTTGCTGAGATGCAGCACACTGG - Intronic
1019202492 6:170329813-170329835 CTTGATGAAGAGAAGAAGAGTGG - Intronic
1019332230 7:466147-466169 GCTGATGAAAAGCAGGAGAGCGG + Intergenic
1021827668 7:24571751-24571773 CTGGATGAAATGAAGTGGAGTGG - Intergenic
1023706055 7:42942811-42942833 GTTGTAGAAATGCAGGAGAGGGG + Intronic
1024672812 7:51612155-51612177 CTTCCTGGAAAGCAGCAGAGAGG + Intergenic
1024708800 7:51992059-51992081 CTTCATGAAATGAATTAGAGAGG + Intergenic
1024832499 7:53477949-53477971 CTGGAGTAACTGCAGCAGAGGGG - Intergenic
1024835272 7:53510970-53510992 CATGAAGAATTGAAGCAGAGTGG + Intergenic
1026002712 7:66574388-66574410 CATGATGAAATCCAGAATAGTGG - Intergenic
1026029145 7:66774411-66774433 CATGATGAAATCCAGAATAGTGG + Intronic
1027766673 7:82352773-82352795 CTTGACAAAATTGAGCAGAGAGG + Intronic
1028220341 7:88189587-88189609 CTTAATTAAAAGTAGCAGAGTGG + Intronic
1028659571 7:93253970-93253992 CTAGATGAAACACAACAGAGAGG + Intronic
1028777513 7:94695772-94695794 CTTTATGAAAGGCAGCAAAAAGG - Intergenic
1030801434 7:113857156-113857178 CCAGAAGAACTGCAGCAGAGAGG + Intergenic
1030871217 7:114758464-114758486 CATGATGAGATGCAGCTAAGAGG - Intergenic
1032794539 7:135267210-135267232 CTGGAAGAAATGCAGCTCAGAGG - Intergenic
1033756243 7:144399881-144399903 CTTGAAGAACTGGAGAAGAGGGG + Intronic
1038932942 8:32215548-32215570 CATGAGGAAATGCCTCAGAGAGG + Intronic
1039019747 8:33191895-33191917 CGTGATGAAGTGTAGCAGAATGG + Intergenic
1039609373 8:38906936-38906958 CTGTATGAAATACAGCAGACAGG - Intronic
1039748493 8:40455007-40455029 CTTGACTCAAGGCAGCAGAGAGG + Intergenic
1040088006 8:43365576-43365598 CTTGACCTAATGCTGCAGAGAGG + Intergenic
1043548424 8:81341022-81341044 CTAGATGAGAGGCAACAGAGAGG - Intergenic
1043672056 8:82898764-82898786 CTTCATGAAATGAATTAGAGAGG + Intergenic
1043724947 8:83599626-83599648 ATTGAGGAAATACAGAAGAGAGG + Intergenic
1044587471 8:93881525-93881547 CTTGAAGGGGTGCAGCAGAGAGG - Intronic
1046769932 8:118108849-118108871 ATTCATGAAATGCAGAATAGGGG - Intronic
1047618087 8:126579891-126579913 CTCAATGAGATGCAGCAGAAAGG - Intergenic
1047660913 8:127035683-127035705 CTTGCTGAAATACAGCAGAAAGG - Intergenic
1048291128 8:133182593-133182615 CTTTAAGAAATACGGCAGAGTGG - Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050906130 9:11008947-11008969 TTTGATAAAATTCAGCAGTGAGG + Intergenic
1051774872 9:20622314-20622336 CTTCATGAATTACAGCTGAGGGG - Exonic
1052615417 9:30833335-30833357 TTTGATTAAATTCAGTAGAGAGG + Intergenic
1053271126 9:36750205-36750227 CTGGCAGAAATGCAGCAGAAAGG - Intergenic
1056344975 9:85683682-85683704 GTTGATGAATTGGAGCACAGAGG - Intronic
1056738110 9:89226847-89226869 CTCGATGAAAAGCAGTAGAAAGG - Intergenic
1056812355 9:89774678-89774700 CTAGATGAGAGGCCGCAGAGGGG + Intergenic
1057388075 9:94621898-94621920 CTCTATGAAATGAGGCAGAGGGG - Intronic
1059639871 9:116205935-116205957 GTTGAAGCAATGCAACAGAGTGG - Intronic
1060977664 9:127774457-127774479 CTTGAAGAACTCTAGCAGAGGGG + Exonic
1061762782 9:132862015-132862037 CTTTATAAAATTCAACAGAGAGG - Intronic
1062322532 9:135997377-135997399 CCTGGGGAAATGCTGCAGAGAGG - Intergenic
1189907182 X:45773442-45773464 CTTAATGAAAGACAGCATAGAGG - Intergenic
1195112875 X:101665187-101665209 CTTCATGAAAGGCAGCAAAAGGG - Intergenic
1195604659 X:106791422-106791444 ATAGATGAAATGCATCAGAGTGG + Intronic
1196538224 X:116873022-116873044 CTGGATGTAATGCACCAGAAAGG + Intergenic
1198463573 X:136885048-136885070 GCTGATGTAATGCAGGAGAGGGG + Intergenic
1199663507 X:150078271-150078293 TTTGGAGGAATGCAGCAGAGGGG - Intergenic
1200624491 Y:5494746-5494768 TTTTATGAAATGGAGCAGTGAGG + Intronic
1201100577 Y:10668600-10668622 CGGAATGGAATGCAGCAGAGTGG - Intergenic
1201117922 Y:10848696-10848718 TTTAATGCAATGGAGCAGAGTGG - Intergenic
1202129656 Y:21598191-21598213 CAGGATGAAAGGCAGCAGTGAGG - Intergenic
1202259276 Y:22953173-22953195 TATGATGGAATGCAGCAGAAAGG + Intergenic
1202412262 Y:24586917-24586939 TATGATGGAATGCAGCAGAAAGG + Intergenic
1202458518 Y:25083153-25083175 TATGATGGAATGCAGCAGAAAGG - Intergenic