ID: 975192014

View in Genome Browser
Species Human (GRCh38)
Location 4:71475503-71475525
Sequence TTACACAGCCTGGGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975192014_975192017 0 Left 975192014 4:71475503-71475525 CCAGTTTTTCCCAGGCTGTGTAA 0: 1
1: 0
2: 0
3: 13
4: 245
Right 975192017 4:71475526-71475548 AAAGTCAGTGCTAAGTAACTAGG 0: 1
1: 0
2: 0
3: 11
4: 159
975192014_975192018 15 Left 975192014 4:71475503-71475525 CCAGTTTTTCCCAGGCTGTGTAA 0: 1
1: 0
2: 0
3: 13
4: 245
Right 975192018 4:71475541-71475563 TAACTAGGAAGTTGTCCAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975192014 Original CRISPR TTACACAGCCTGGGAAAAAC TGG (reversed) Intronic
902131991 1:14269977-14269999 TTCCACAGCCTGGGAAGTTCAGG + Intergenic
903201400 1:21742685-21742707 TTACACAGACTGGAAGAACCTGG - Intronic
903262532 1:22139137-22139159 TGGGACAGCCTGGGATAAACAGG + Intronic
904844755 1:33401778-33401800 TTAAACAGTATGGGAAAACCAGG + Intronic
906919910 1:50052921-50052943 TTGCACAGCCTCTGAACAACTGG + Intronic
910462073 1:87458340-87458362 TTACCCAGGCTGGGGAACACTGG + Intergenic
912126576 1:106546267-106546289 TTACAAAGCCAGGAAACAACAGG - Intergenic
912324288 1:108743399-108743421 TTATACAGGTAGGGAAAAACGGG + Intergenic
913470252 1:119179409-119179431 TTACACAGCGTGGGACTGACAGG + Intergenic
914358620 1:146910617-146910639 TTTCACAGGCTGGGAAACAAAGG - Intergenic
914998305 1:152564035-152564057 TGACACAGGCTGGACAAAACTGG - Intronic
917789888 1:178492743-178492765 TTCTACACCCTGGGAAAAAATGG + Intergenic
917912792 1:179668603-179668625 ATACACAGGCTGGGAAAGAGGGG - Intronic
917916842 1:179710577-179710599 TGACACAGCCTGTGTCAAACAGG - Intergenic
920374872 1:205502865-205502887 TTACCCCTCCTGGAAAAAACAGG + Intergenic
920597109 1:207283100-207283122 TTCCAAAGCCTGAGAAAAGCAGG - Intergenic
920925145 1:210334212-210334234 TGATCCAGCCTGGGAAACACAGG - Intronic
921286413 1:213613733-213613755 TCACACAGTCTGGGCAAAGCAGG + Intergenic
922771063 1:228183188-228183210 TTCCACAGCCTGGGCAACAGAGG + Intergenic
923056931 1:230433656-230433678 TTTCAAACCCTGGGAAAAAAAGG - Intergenic
923232053 1:231995999-231996021 TTAAAAAGTCAGGGAAAAACAGG - Intronic
923333540 1:232947337-232947359 TCACAGAGCCTGGGAGAAAGGGG + Intergenic
923693992 1:236228291-236228313 TTCCACAAACTGTGAAAAACAGG + Intronic
1063208497 10:3857256-3857278 TTACACAGCCTGAGTGATACCGG + Intergenic
1064339018 10:14470078-14470100 TTACATAGGGTGTGAAAAACTGG - Intergenic
1065130909 10:22619317-22619339 TTACAGAGGCAGGAAAAAACGGG + Intronic
1065538810 10:26740645-26740667 GTTCACTGCCAGGGAAAAACTGG + Intronic
1065574913 10:27107972-27107994 TTACACAACCTGAGAAATAGAGG + Intergenic
1065961077 10:30734837-30734859 TTCCACACCCTGAGAAAAAATGG - Intergenic
1067027199 10:42854177-42854199 TTTGACAGCCTAGGAAAAAATGG - Intergenic
1068306255 10:55212225-55212247 TTGCATAGGCTGTGAAAAACTGG - Intronic
1068319919 10:55399030-55399052 TTACTCATCTTGTGAAAAACAGG + Intronic
1069528002 10:69191155-69191177 TTACACAACTTGGGTAAACCTGG - Intronic
1070547569 10:77464653-77464675 TCACACAGCCAGTGAGAAACAGG + Intronic
1070903731 10:80053430-80053452 TTTTACAACCAGGGAAAAACTGG - Intergenic
1072255639 10:93617844-93617866 TTACACAGCCTGGGCACTAAAGG - Intronic
1072632977 10:97159476-97159498 TTACACTGCCTGGTAACCACTGG + Intronic
1072902842 10:99424784-99424806 GAACTCAACCTGGGAAAAACTGG - Intronic
1074746696 10:116541622-116541644 TAACACAGCCTGGGAAAAGATGG + Intergenic
1074765858 10:116699516-116699538 TTACCCAGCCTGGGACAATCTGG - Intronic
1077434153 11:2530440-2530462 TCTCACAGCCTGGGAACCACTGG - Intronic
1078567701 11:12431164-12431186 CTACACAGGATGGGAAACACTGG - Intronic
1079212265 11:18473186-18473208 TTACAAAGCCTGGGTAAAAATGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1081085893 11:38800382-38800404 TTCCATAGCCTGGGAAGATCAGG + Intergenic
1081647190 11:44798356-44798378 TTTCACAGACAGGGAAAGACGGG + Intronic
1081997797 11:47376397-47376419 TCACACAGCCTGGGCAAGAGTGG + Intronic
1082846751 11:57732370-57732392 TTATACAGTTTGGGAAAAAGAGG - Intronic
1084406450 11:68976757-68976779 TTACACAGCTGGGGAAGAAGAGG + Intergenic
1086144867 11:83540552-83540574 TCGCACAGCCTGGGAAAGAATGG - Intronic
1087920424 11:103860759-103860781 TTAGACAGCCTTGGAAGAACAGG - Intergenic
1088172555 11:107015810-107015832 TTACGCTGCCTGGGAAATATTGG + Intronic
1089325265 11:117652569-117652591 TTACCCAGGCTGGGAAGAAGAGG + Intronic
1090214796 11:124952501-124952523 TTACAGAGGCTGAGAAAAAGAGG - Intergenic
1093057366 12:14568219-14568241 TTAAACAGCCTGGGAATGAGGGG - Exonic
1094681436 12:32670740-32670762 TTAGAGTGCCTGGGAAAAACAGG + Intergenic
1097310899 12:58117874-58117896 TTACACAGCCTGCTCCAAACTGG - Intergenic
1098509949 12:71299919-71299941 TTATAAAGCCTGGGAATAATTGG + Intronic
1100078514 12:90819533-90819555 TTACACATACTGGGAAGAAGTGG + Intergenic
1100603387 12:96131389-96131411 TTGCATAGCATGGGAAGAACTGG + Intergenic
1101421380 12:104554208-104554230 TTACACAGGCTGTGAATACCAGG + Intronic
1102949609 12:117022059-117022081 TTCCACAGCCTAGGAAAAGGAGG - Intronic
1102997711 12:117362453-117362475 TCACACAGTCTTGGGAAAACGGG + Intronic
1104668950 12:130667432-130667454 TTCCACAGGCTGGCAAAATCTGG + Intronic
1107007269 13:35627540-35627562 TTACACAGTTTGGGAATCACTGG - Intronic
1107366594 13:39685458-39685480 TTACCAAGCCTGGCAAACACTGG - Intronic
1107722025 13:43259042-43259064 TTACCCAGCCTTGGACACACTGG - Intronic
1108520793 13:51245258-51245280 TTGCACAGCATGTGAAAATCTGG + Intronic
1108927812 13:55775282-55775304 TTACAGAGAAAGGGAAAAACTGG + Intergenic
1111998627 13:95189810-95189832 TTACCCATCCTGGGAAAATAGGG + Intronic
1117521402 14:56554836-56554858 TTGCACAGACTGGGAAACTCTGG + Intronic
1117648766 14:57880367-57880389 TTACACAGCCAGGGGACCACTGG - Intronic
1117719446 14:58614819-58614841 TGCCACAGCCTGGGAGATACTGG - Intergenic
1117982654 14:61357218-61357240 TTAAATAGCATGGGAGAAACGGG - Intronic
1118729595 14:68656966-68656988 TTAAGCAGCCTGGTTAAAACAGG + Intronic
1120821326 14:88914401-88914423 TTTCATACCCTGGGAGAAACAGG + Intergenic
1123426814 15:20178697-20178719 TTTGACAGCCTAGGAAAAAATGG - Intergenic
1123536046 15:21185224-21185246 TTTGACAGCCTAGGAAAAAATGG - Intergenic
1124422495 15:29535043-29535065 TGAGACAGCCTGGGCAACACAGG + Intronic
1126014188 15:44334056-44334078 TTACACTGGCTTGGAAAAAAAGG - Intronic
1126407354 15:48334797-48334819 TTACACATTCTGGGACCAACAGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127253132 15:57263736-57263758 GTATACAGCCTAGGAACAACAGG - Intronic
1127858051 15:62968635-62968657 TTACAGAGCCAGGGAAGACCAGG + Intergenic
1128393686 15:67201512-67201534 TTACACAGCATGAAAGAAACAGG - Exonic
1130202225 15:81842676-81842698 TTACACAGAGAGGGAAAATCGGG + Intergenic
1130804946 15:87310152-87310174 TTACACTTCCTGGGAAAATGTGG + Intergenic
1131787650 15:95930467-95930489 TTACACAGCATGTCAAAAATAGG - Intergenic
1131893281 15:96997717-96997739 ATACACATCCTGGGGAGAACTGG - Intergenic
1135071850 16:19358884-19358906 TTGCACAGCCTGGGCAACATAGG + Intergenic
1135590795 16:23704096-23704118 GTAGACAGCTTGGGAAAATCAGG - Intronic
1135825370 16:25722638-25722660 TTATACAGCCTTGAAAACACAGG + Intronic
1135880157 16:26247858-26247880 GAACACTGCCTGGGAAAAATAGG + Intergenic
1137048535 16:35689573-35689595 TTATACAGCCTGGGATCAGCTGG + Intergenic
1138418684 16:56885821-56885843 TTACACAGCCTTACAAGAACCGG + Intronic
1139197217 16:64933515-64933537 TTATACAGCCTGGCCAAAAGGGG - Intergenic
1139480356 16:67227184-67227206 ATACCCAGCCCGGGAAACACGGG - Exonic
1139525390 16:67512641-67512663 TTGCCCAGCCTGGGAAACATAGG + Intergenic
1139677732 16:68536630-68536652 TTATATAGCCTGGGAAAAGAGGG + Intronic
1140789124 16:78373543-78373565 TTCCACAGCATAGGAAAAAGAGG - Intronic
1203029466 16_KI270728v1_random:562432-562454 TTAAAAAGTCTGGGAACAACAGG + Intergenic
1203042255 16_KI270728v1_random:771999-772021 TTAAAAAGTCTGGGAACAACAGG - Intergenic
1142527545 17:554953-554975 TTACACAGCCTGAACAAAGCGGG - Intronic
1146236379 17:31168548-31168570 ATAAACAGCATGGGAAAAAATGG - Intronic
1147565897 17:41536305-41536327 TTCCACAGCCTGGGAAGACAGGG + Intergenic
1150482412 17:65520680-65520702 CTACCCAGCCTGGGCCAAACTGG - Intergenic
1150915083 17:69428697-69428719 TAACTCAGCCTGGGAAGATCAGG + Intronic
1156762845 18:40614141-40614163 TGAGACAGCCTGGGAAATTCAGG - Intergenic
1157027292 18:43860588-43860610 CTACAGAGCCTGGGAAGAAGTGG - Intergenic
1158132530 18:54169018-54169040 TCACACAGAGTGGGAAAGACTGG - Intronic
1158237960 18:55340377-55340399 TTGCAGAGCCTGGGAAACACAGG + Intronic
1160332967 18:78012225-78012247 TAACACAGGTTGGGAAAATCTGG - Intergenic
1161378465 19:3951865-3951887 TTGCTCAGCCTGGGGAAACCGGG + Intergenic
1164436820 19:28237548-28237570 TTACACAGCCAGGAAGAAGCAGG + Intergenic
1165806385 19:38583610-38583632 TTACAAAGCCTGGGAAGGGCTGG + Intronic
927647534 2:24887461-24887483 TTTCACAGCCTGGGAACACTCGG + Intronic
927791323 2:26011967-26011989 TTACACAGGCTGGGGAGAGCTGG + Intergenic
930119628 2:47749732-47749754 ATAAACACCCTTGGAAAAACTGG + Intronic
930564185 2:52999045-52999067 TCACACAGACTGGGAAAGAGGGG + Intergenic
930852026 2:55971789-55971811 TTTCAGAGCCTGTGAAATACTGG + Intergenic
933245001 2:79965241-79965263 TCACACAGCCTGGCAGAAAAAGG - Intronic
935887367 2:107636743-107636765 TTAAACAGCATGTGAAAAAATGG - Intergenic
936024345 2:109019968-109019990 TTACAGAGCCCAGGGAAAACAGG + Intergenic
936917575 2:117655547-117655569 TTACTCAGACAGGGATAAACTGG + Intergenic
937661947 2:124440388-124440410 TCAGACAGCCTGAGAAAAAGGGG - Intronic
937862341 2:126720858-126720880 TCACACAGCCTGGGGAAGTCTGG + Intergenic
938901352 2:135800960-135800982 TTACACAGCCAGGTAATAAGAGG - Intronic
940923751 2:159340388-159340410 TTCCACATCCTGGGAGAAAGAGG + Intronic
941224050 2:162822796-162822818 TTACAGTGCATGGGAAACACAGG + Intronic
942385874 2:175442202-175442224 TTACACAGCTGGGCATAAACGGG + Intergenic
943120003 2:183723943-183723965 TTCCACAGGCTGTTAAAAACTGG + Intergenic
943946223 2:194069112-194069134 TTAAAAAGTCTGGGAACAACAGG - Intergenic
944323110 2:198371871-198371893 TTACACATCCTGTGAATATCAGG - Intronic
944323114 2:198371929-198371951 TTACACATCCTGTGAATATCAGG - Intronic
944959986 2:204861705-204861727 TTCTACAGACTGAGAAAAACTGG - Intronic
945451204 2:209998494-209998516 TTGCACAGGCTGGGAGTAACTGG + Exonic
946737981 2:222773585-222773607 TGGCACAGACTTGGAAAAACTGG + Intergenic
947110696 2:226716238-226716260 TAACACAACCTGGGTAACACTGG + Intergenic
947307856 2:228766766-228766788 TGACACAGCCAGGGAACATCTGG + Intergenic
947411278 2:229843117-229843139 TTACAGAGCCTGGGAAAGGGGGG - Intronic
948158744 2:235806885-235806907 TCACACAGCCGAGGAAAAAAGGG - Intronic
1169876546 20:10303637-10303659 TTCTACAGCCTGGGAAGAAGAGG - Intronic
1170322249 20:15112920-15112942 TTATCCAGCCTGGAAAAAAAAGG - Intronic
1170379680 20:15743408-15743430 TGACGCAGCCTAGGAAAAAAGGG + Intronic
1170822388 20:19765556-19765578 TTACACAGACTGGGAAGGGCAGG + Intergenic
1172962407 20:38807789-38807811 TTACAGAGGCTGGGAAGAGCTGG - Intronic
1178960668 21:37061853-37061875 TCTCACAGCCTGGGCAACACAGG + Intronic
1181377558 22:22472118-22472140 TAAGACAGCCTGGCAAACACAGG + Intergenic
1182044588 22:27264279-27264301 TTCCACAGCCTGGGGACAGCAGG + Intergenic
1183180125 22:36254361-36254383 CAAGACAGCCTGGGAAACACAGG + Intronic
949271120 3:2218037-2218059 TTTCACAGGATGAGAAAAACAGG + Intronic
949460922 3:4292898-4292920 TTACAGAGCCTGGAAATTACAGG - Intronic
949471870 3:4404964-4404986 TTTCTCAGTCTGGCAAAAACCGG - Intronic
949956087 3:9269764-9269786 TTATTCAGACTAGGAAAAACTGG - Intronic
950907167 3:16549732-16549754 TTAAATAGTCTGGGAACAACCGG + Intergenic
950989802 3:17420873-17420895 TTACACAGCCTTGGATGATCAGG + Intronic
951296646 3:20944424-20944446 TTAAAGAGCCTGGAAAAAATTGG - Intergenic
953325432 3:42008723-42008745 TTCCTCAGCCTGGGCAAAATAGG - Intergenic
954586403 3:51740609-51740631 TTCCACAGCCAGAGAAAAATGGG + Intergenic
956213905 3:66828470-66828492 TGACACAGCCTGGCACAAGCAGG - Intergenic
956253963 3:67264090-67264112 TTACATAGGGTGCGAAAAACTGG - Intergenic
957587874 3:82155842-82155864 ATCCACAGCCTGGTAAGAACAGG + Intergenic
958455728 3:94328478-94328500 TGACCCAGCCTGGGCAACACAGG - Intergenic
959457979 3:106587881-106587903 TTACAATGCCTGGGAAAACATGG - Intergenic
959553162 3:107687245-107687267 TTGCATAAACTGGGAAAAACAGG + Intronic
960456266 3:117876337-117876359 TTACATAGACTGTGAAAGACAGG - Intergenic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962531966 3:136290558-136290580 TGAACCAGCCTGGGAAACACAGG - Intronic
962819969 3:139038995-139039017 TAACCCAGCCAGGGAAATACTGG - Intronic
963102470 3:141620462-141620484 TTACAGAGCCTGGGAAGGCCCGG + Intergenic
963479300 3:145850488-145850510 TTACAAAGCCTGAGTAAAAATGG - Intergenic
964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG + Intergenic
964369208 3:155982287-155982309 TTAGACAGCCAGAGAAACACAGG - Intergenic
964809275 3:160645398-160645420 TCACACATCCTGACAAAAACTGG - Intergenic
964896795 3:161607338-161607360 TTACACTGCTTTGGAAGAACTGG + Intergenic
965693947 3:171387399-171387421 TTACACACACTGGCAAACACTGG - Intronic
965967871 3:174518040-174518062 TTGCACAGACTCGAAAAAACTGG + Intronic
970571037 4:17383216-17383238 TTACAAAGTCAGGGAACAACAGG - Intergenic
971849988 4:31972885-31972907 TTATACAGCCTGAGAAAACAAGG - Intergenic
974269174 4:59628206-59628228 TTACAAAGTCAGGAAAAAACAGG + Intergenic
975175091 4:71279421-71279443 TTATTCAGCCTTTGAAAAACAGG - Intronic
975192014 4:71475503-71475525 TTACACAGCCTGGGAAAAACTGG - Intronic
978292509 4:107159924-107159946 TTACACATCCAGGGGAAAAAAGG + Intronic
981054861 4:140350179-140350201 TAACACAGCCTGGGAAGATCAGG - Intronic
982071818 4:151702156-151702178 AGACACAGGCTGGAAAAAACAGG + Intronic
982829286 4:160041236-160041258 TTACACAGCATGTGAAAAGCTGG + Intergenic
985876448 5:2602276-2602298 TGCCACAGCCTAGGAAAAATGGG + Intergenic
987053533 5:14168467-14168489 TTACACAGCCTGATATAAATCGG + Intronic
987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG + Intergenic
988087774 5:26493925-26493947 TAAAACTGCCTTGGAAAAACTGG + Intergenic
988768914 5:34411382-34411404 TTACAAGGCTTGGGAAAAAGGGG - Intergenic
989533079 5:42530706-42530728 TGACACAGCTTGTGCAAAACTGG - Intronic
990163646 5:52971327-52971349 TTACAAAGTCAGGGAACAACAGG - Intergenic
992313084 5:75522747-75522769 ATACAGAGCATAGGAAAAACAGG + Intronic
996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG + Intergenic
998327623 5:141295696-141295718 TCACCCAGCCTGGGCAACACAGG - Intergenic
999306059 5:150520468-150520490 TTGCACAGCCTGGGAACTAGAGG - Intronic
999780451 5:154845538-154845560 TGAGTCAGCCTGGGAAACACAGG + Intronic
1001182566 5:169534203-169534225 TTACACAGACTGAGAAAGATGGG - Intergenic
1002148629 5:177207641-177207663 TAGCCCAGCCTGGGAAACACAGG - Intronic
1003299502 6:4864617-4864639 CAACACAGCATGAGAAAAACCGG - Intronic
1004958840 6:20762183-20762205 TAACTCAGCCTGGGAGTAACAGG - Intronic
1005488524 6:26324146-26324168 TCCCCCAGCCTGGGAAACACAGG - Intergenic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1008465681 6:51827977-51827999 TCACACATGCTTGGAAAAACTGG - Intronic
1010816848 6:80368164-80368186 ATTCAGAGGCTGGGAAAAACTGG - Intergenic
1015257416 6:131194902-131194924 GCACACAGACTGGGAAAAAAAGG - Intronic
1016270722 6:142286880-142286902 TTATGCAGCCTGGCAAAAATAGG - Intergenic
1018964207 6:168471420-168471442 TTACTCAGCCTTGGAAAAGAAGG - Intronic
1020385156 7:7592853-7592875 GTCCACAGCCTGGTACAAACTGG - Intronic
1020498497 7:8887422-8887444 TTACATAGGCTGTGAAATACGGG + Intergenic
1020852867 7:13378816-13378838 TTAAAAAGTCAGGGAAAAACAGG + Intergenic
1021396807 7:20159408-20159430 TTACACAGCTTGGGTAAAGAAGG - Exonic
1021498329 7:21301206-21301228 TGACACAGCCTGTGGAAAATTGG + Intergenic
1023329387 7:39098651-39098673 TTACCCAGCCAGTGAAAAAGTGG - Intronic
1023358382 7:39390705-39390727 TTATACACTCTGGGAAAAGCTGG - Intronic
1024781076 7:52848742-52848764 TAACGGAGCCTGGGAAAAAAAGG - Intergenic
1025078246 7:55962099-55962121 TTACTCAGCCTGTGAGGAACTGG - Intronic
1025944116 7:66093113-66093135 TGACACAGCCTGGGCAACACAGG + Exonic
1027262770 7:76476929-76476951 AAAAACAGCCTGGGAAATACAGG - Intronic
1028287130 7:89015995-89016017 TTACAAAGCCAGGAAACAACAGG - Intronic
1030045068 7:105487737-105487759 TAACAAAGCCAGGGAAATACTGG + Intronic
1030741977 7:113120511-113120533 TCATACAGCTTGGGAAAAATGGG - Intergenic
1032642688 7:133787402-133787424 TGACACAGCCTGGGCAATATAGG - Intronic
1035436251 7:158862224-158862246 GGCCACAGCCTGGGAAACACTGG + Intronic
1038026617 8:23596586-23596608 TAAGCCAGCCTGAGAAAAACAGG - Intergenic
1038085997 8:24196854-24196876 TGACACAGCCTTGGAGAAATAGG + Intergenic
1039886584 8:41657609-41657631 ATATGCAGCCTGGGAAAGACAGG + Intronic
1040842581 8:51800427-51800449 TCACGCAGCCTGGGAGTAACAGG + Intronic
1042443010 8:68849495-68849517 TTGCCCAGCCTGGGAAACATAGG - Intergenic
1044363413 8:91315033-91315055 TTGCCCTGCCTGGGAAAAAAAGG - Intronic
1046983941 8:120366885-120366907 TCACACAGCCTGCCAAGAACTGG - Intronic
1047251424 8:123184265-123184287 TAACACAGCCTGGGGAATTCAGG - Intronic
1047712594 8:127567408-127567430 TAACAAAGTCTAGGAAAAACTGG - Intergenic
1047758056 8:127933739-127933761 TTACACTGCCTTGGAAGAAATGG - Intergenic
1049927512 9:423866-423888 TTACACAGCCCAGGCAAAACAGG - Intronic
1051142268 9:13990242-13990264 TTGCACAGCCTTGTAAATACTGG + Intergenic
1051320214 9:15895176-15895198 TTACACAGTCCTTGAAAAACAGG - Intronic
1051663301 9:19445269-19445291 TTACACACACTGGGACAAAATGG - Intronic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1055131796 9:72783806-72783828 ATACACAGCATTGGAATAACTGG + Intronic
1056778181 9:89529271-89529293 TCACAGGGCTTGGGAAAAACAGG - Intergenic
1057871885 9:98724335-98724357 ATACTCAGCCTGGGAAACACAGG - Intergenic
1059904835 9:118971062-118971084 TTACAAGGCCTGGCATAAACTGG - Intergenic
1061053850 9:128211384-128211406 TTACAGTGCGTGGGAAAAATAGG + Intronic
1061206159 9:129164717-129164739 TCAAACAGCCTGGGGAGAACTGG - Intergenic
1062358431 9:136176053-136176075 TCGCAGAGCCTGGGAAAAGCGGG - Intergenic
1185961522 X:4550130-4550152 ATACAGAGCCTGGGAAAAGTCGG - Intergenic
1186537142 X:10361781-10361803 TCACACAGCCTGGGGAAAGGAGG + Intergenic
1187539767 X:20180901-20180923 ATAAACAGCAGGGGAAAAACAGG + Intronic
1188230043 X:27650894-27650916 TCATACTGCATGGGAAAAACTGG - Intronic
1189985079 X:46546085-46546107 TTAGACACCCTGGGAGAATCTGG + Intergenic
1191915706 X:66199219-66199241 TTACACAGTATGGGGGAAACTGG + Intronic
1192860681 X:75067161-75067183 TTACACAGCCTTGCCCAAACTGG + Intronic
1193000445 X:76557017-76557039 CTACACAGGGTGTGAAAAACTGG + Intergenic
1195921929 X:109992364-109992386 TGACACAGCCTGGAAAAACTTGG - Intergenic
1197854796 X:130903081-130903103 TTATACAGCCGCGGAAAATCGGG + Exonic
1198575161 X:138002466-138002488 GGACACAGCCTTGGAATAACTGG - Intergenic