ID: 975192055

View in Genome Browser
Species Human (GRCh38)
Location 4:71475946-71475968
Sequence CCTTCTAGGCATACATTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975192049_975192055 25 Left 975192049 4:71475898-71475920 CCTTGAAGTGTAAGTAATAGAAT 0: 1
1: 0
2: 0
3: 10
4: 244
Right 975192055 4:71475946-71475968 CCTTCTAGGCATACATTGTAGGG 0: 1
1: 0
2: 2
3: 13
4: 97
975192050_975192055 -5 Left 975192050 4:71475928-71475950 CCTATCTTCATCATCCTTCCTTC 0: 1
1: 1
2: 0
3: 61
4: 638
Right 975192055 4:71475946-71475968 CCTTCTAGGCATACATTGTAGGG 0: 1
1: 0
2: 2
3: 13
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975192055 Original CRISPR CCTTCTAGGCATACATTGTA GGG Intronic
905763054 1:40576651-40576673 ACTTCTAGGTATTCATTCTAGGG + Intergenic
905984901 1:42271154-42271176 CCTTCATGGCATACATTCCAAGG - Intronic
909937347 1:81568203-81568225 CTTTCTAGAAATACATTGCATGG - Intronic
910538420 1:88326669-88326691 CCTAGTAGGCATTCAATGTATGG - Intergenic
913199694 1:116485586-116485608 CCTTCAAGGCATACCTGTTAGGG - Intergenic
915867743 1:159522677-159522699 CCTTCTATGCATAGTTTGTTGGG + Intergenic
919848088 1:201654255-201654277 CCTTCTAGACCTGCATTGAATGG + Intronic
919944591 1:202310028-202310050 TCTCCTAGGCATTCTTTGTAAGG - Intronic
920719350 1:208372408-208372430 CCTTCTCAGCATACCATGTATGG + Intergenic
922285544 1:224167741-224167763 GCTTCAAGGCATACATTTTGCGG - Intergenic
924443652 1:244108079-244108101 CATTCTAGGCAAACATTTTTTGG - Intergenic
1065578595 10:27149286-27149308 CCTTCTAGGAATTTATTATAAGG + Intronic
1071238932 10:83682227-83682249 CCTTCTAGGCATATATCCAAGGG - Intergenic
1071815335 10:89226256-89226278 CCTTCTAGGAATATATTGTAAGG + Intronic
1073191626 10:101655191-101655213 ACTTCTAGGAATTCATTGTAAGG - Intronic
1079650272 11:22919889-22919911 CCTTGTAAACATACTTTGTAAGG - Intergenic
1084899851 11:72301543-72301565 CCTTCTAGAGAGACATGGTATGG - Intronic
1086491199 11:87359400-87359422 ACTTCTATGTACACATTGTAAGG + Intergenic
1088663295 11:112069748-112069770 CCTAGTAGGCAGACATTGTGAGG - Intronic
1088989710 11:114942024-114942046 CCTTCTAGGCATTCTTTCTAAGG - Intergenic
1090466463 11:126939035-126939057 CCTGCCAGGCACACATAGTACGG + Intronic
1090790484 11:130089298-130089320 CCTGCTATGCATACTTTGGAAGG - Intronic
1093845342 12:23964521-23964543 CCTTCAAGGCCAACTTTGTAAGG + Intergenic
1095802189 12:46281073-46281095 CCTTCTAGGCAGACTTGGGAGGG - Intergenic
1096421719 12:51464432-51464454 TCTTCTAGGCCAACATTTTAAGG + Intronic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1099038430 12:77619554-77619576 CCTTCTAAGCAGGCATTGCATGG + Intergenic
1100241954 12:92718573-92718595 CCTTTTAGGGAAAAATTGTATGG + Intergenic
1112986273 13:105454056-105454078 TGTTCTAGGCAAACATTTTATGG - Intergenic
1115295999 14:31827718-31827740 ACTTGTAGGCATACAATTTAGGG - Intronic
1115694937 14:35886696-35886718 CTTCCTATCCATACATTGTATGG - Intronic
1117656300 14:57960117-57960139 CCTTCTAGGATAACATGGTAAGG + Intronic
1117871827 14:60209248-60209270 CCTTTTAGGCTTGCACTGTATGG + Intergenic
1118033543 14:61841262-61841284 CATTCTTAGCAGACATTGTATGG + Intergenic
1119785917 14:77314136-77314158 CATTCTTGGCATACCTTGCAAGG - Intronic
1121955943 14:98213089-98213111 CCTTCTTGGGTTTCATTGTAAGG + Intergenic
1127246003 15:57175463-57175485 CCTTCTAGACTTATGTTGTATGG + Intronic
1129560928 15:76567391-76567413 ACTTCTAGGTATATACTGTATGG - Intronic
1130398370 15:83525580-83525602 TGTTCTAGGCAAACATTTTATGG - Intronic
1134035777 16:11030197-11030219 CTGTATGGGCATACATTGTATGG - Intronic
1138324582 16:56153655-56153677 CCTTGCATGCATATATTGTATGG + Intergenic
1139770685 16:69273670-69273692 ACTTCAAGGGATAAATTGTATGG + Intronic
1142617980 17:1147718-1147740 CCTTCTGAGCATACATGGAAGGG - Intronic
1149594612 17:57857105-57857127 CCTTGAAGGCATACATTTCAGGG + Intergenic
1157199816 18:45650608-45650630 CCTTCAAGGAATTCATTTTATGG + Intronic
1158007090 18:52685233-52685255 CCTTCTTAGAATACATTGGAGGG + Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1158703061 18:59766588-59766610 CCCACTGGGCAGACATTGTAAGG + Intergenic
1161700122 19:5789887-5789909 TCTCCTCGGGATACATTGTAGGG - Intronic
1163742392 19:19023572-19023594 CCTTCTAGTAATACCTTGTGGGG + Intronic
1168523838 19:57073227-57073249 ACTTCTAGAAATATATTGTACGG - Intergenic
926454363 2:13046064-13046086 CCTTCTATCCTGACATTGTAAGG + Intergenic
936468896 2:112780115-112780137 ACTTCTAGGAATATATTCTAAGG + Intronic
939271112 2:139940767-139940789 TCTTGTAGGCATACATCTTAAGG - Intergenic
941614447 2:167703316-167703338 CCTTCTAGGCATCTAATGTAGGG - Intergenic
943379147 2:187121098-187121120 TCTACAATGCATACATTGTAGGG - Intergenic
943759037 2:191588490-191588512 ACTTCTAGGAATTTATTGTAGGG + Intergenic
946630178 2:221658556-221658578 CCTTCTAGGCCAACATTGAAGGG - Intergenic
948505402 2:238424385-238424407 TCTTCCAGGCATTCATTCTAGGG - Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173036005 20:39411185-39411207 CCTTCTAGGACTTCATTCTAAGG - Intergenic
1173187555 20:40852527-40852549 CCTTATAGGCATGAATTGCAAGG + Intergenic
1175291297 20:57877279-57877301 TCTTCTAGTCACACATTGAAAGG - Intergenic
1179421383 21:41239327-41239349 CCTGTGAGGCATACTTTGTAAGG + Intronic
1183232962 22:36594254-36594276 CCTTCCAGGCTCACATTCTAGGG + Intronic
951651017 3:24951590-24951612 TCTACTAGGCATCCATTGTGAGG + Intergenic
953292444 3:41679077-41679099 CCTTCCTGGCATATATAGTAAGG - Intronic
953762928 3:45706614-45706636 CTTTCTATTCATAAATTGTAAGG + Intronic
954828646 3:53398931-53398953 CCTTCAATACATACATTGTAAGG + Intergenic
958476095 3:94584943-94584965 CATTCTAGGCATACATTTTAGGG + Intergenic
962195593 3:133360482-133360504 CCCTCTAGGCATCCATTCTCTGG + Intronic
967103617 3:186237444-186237466 CCATCCAGTCATACCTTGTATGG - Intronic
972710802 4:41592616-41592638 CCTTCTGGGCACTCATTGTCTGG - Intronic
975192055 4:71475946-71475968 CCTTCTAGGCATACATTGTAGGG + Intronic
975985472 4:80197975-80197997 CCCTCTAGGCAGGCATTGTCTGG - Intronic
979917991 4:126462886-126462908 TCTTCTGGGTATACATTTTAGGG + Intergenic
980315622 4:131196123-131196145 CCTTCTATGCCCACCTTGTAGGG + Intergenic
980624096 4:135349633-135349655 AGGTCTAGGCATACATTTTATGG + Intergenic
980881754 4:138717720-138717742 GCTTCTAGGCATTCATTCTAAGG - Intergenic
983052065 4:163060135-163060157 CCTTCTTCGCATCCATAGTAAGG - Intergenic
984065793 4:175046194-175046216 CCTTCCTGGCATACATTCCATGG - Intergenic
990477343 5:56174153-56174175 CTTTCTAGGAATATATTCTAAGG - Intronic
990949095 5:61278610-61278632 CCTTCTTGGGTTACATTGTTGGG + Intergenic
991628785 5:68632823-68632845 CCTTCTAGGAATATATTTCATGG + Intergenic
992302242 5:75394798-75394820 GCTTCTAGGAATATATTCTAAGG + Intronic
995869311 5:116727682-116727704 CCTGCTAGGCATTCTTGGTAGGG - Intergenic
1004115776 6:12766273-12766295 CCTTCTATGAATTAATTGTAAGG - Intronic
1006533653 6:34679399-34679421 AATTCTAGGAATAAATTGTAAGG + Intronic
1008804742 6:55413581-55413603 CCTGATATGCATACATGGTATGG + Intergenic
1008942527 6:57062539-57062561 TCTTCTAGGAATACTTTGAATGG - Intergenic
1009338994 6:62530079-62530101 GCTTCTGAGCATACATTTTATGG - Intergenic
1010963784 6:82178943-82178965 CCTTCAAGGCCTACATAGTCTGG - Intronic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1011994772 6:93571957-93571979 CATTCTAGGCTTAAATTTTATGG + Intergenic
1013963737 6:115930325-115930347 ACTTCTAGGAAGACTTTGTATGG - Intergenic
1014048051 6:116916830-116916852 CCTTCTAGGCAAACATTTAATGG + Intronic
1014550520 6:122785035-122785057 CCTTCTTGCTAAACATTGTATGG - Intergenic
1015367989 6:132418593-132418615 TCTTCTATGCATCCATTCTAAGG + Intergenic
1015415591 6:132944273-132944295 CCTTCTAGACAGCCATTGTAAGG - Intergenic
1021145385 7:17082200-17082222 CTTTCATGGCATACATTTTATGG + Intergenic
1021455769 7:20828322-20828344 CTCTCTAGGCATTCATCGTAGGG - Intergenic
1021456075 7:20830836-20830858 CTCTCTAGGCATTCATCGTAGGG - Intergenic
1032752208 7:134852589-134852611 CCTTCTAGGCAGTCATTGAATGG + Intronic
1037093605 8:14954245-14954267 ACTACTAGGTATACATGGTATGG + Intronic
1037603642 8:20419706-20419728 CCTTCTATGCACACAGTGTGTGG - Intergenic
1044301178 8:90585253-90585275 CCTTTTAGAGATACATTGTCAGG - Intergenic
1044464567 8:92488499-92488521 CCATCTAGGCAAACATTGTGGGG + Intergenic
1044562024 8:93621817-93621839 ACTTCCAAGTATACATTGTAGGG + Intergenic
1045647898 8:104317201-104317223 CATAGTAGGCATAAATTGTAAGG - Intergenic
1051857161 9:21581664-21581686 ACTTCTATGTACACATTGTAAGG - Intergenic
1059817539 9:117934474-117934496 CCTTCTAAAGATACATTTTAGGG - Intergenic
1188316381 X:28678935-28678957 ACTTCTGGGCATATATTGAAAGG - Intronic
1195501425 X:105604957-105604979 CTTTCTATGCATACTTTGTAGGG - Intronic