ID: 975192457

View in Genome Browser
Species Human (GRCh38)
Location 4:71481140-71481162
Sequence TCCCACACCACATAATCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975192457_975192463 9 Left 975192457 4:71481140-71481162 CCTCAAGATTATGTGGTGTGGGA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 975192463 4:71481172-71481194 CACTATGCTCAGAAGGTGCTGGG No data
975192457_975192461 2 Left 975192457 4:71481140-71481162 CCTCAAGATTATGTGGTGTGGGA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 975192461 4:71481165-71481187 CTAAGGGCACTATGCTCAGAAGG No data
975192457_975192462 8 Left 975192457 4:71481140-71481162 CCTCAAGATTATGTGGTGTGGGA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 975192462 4:71481171-71481193 GCACTATGCTCAGAAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975192457 Original CRISPR TCCCACACCACATAATCTTG AGG (reversed) Intronic
907328701 1:53657602-53657624 TCCCCCTCCACATAGCCTTGTGG - Intronic
907341857 1:53740747-53740769 CCCACCACCACATACTCTTGTGG + Intergenic
909779445 1:79524399-79524421 TCCCACAACACATTCTCCTGAGG + Intergenic
911280693 1:95924408-95924430 TCCCACACTTCATAAATTTGGGG - Intergenic
912048550 1:105492564-105492586 TCCTTCACAACATAATCTTATGG - Intergenic
913072394 1:115311585-115311607 TCCCACAGCACAGAATCATCTGG + Intronic
913113609 1:115677606-115677628 TCCCAGACCACATAGATTTGTGG - Intronic
917730038 1:177866010-177866032 TTACACACAACATAATCATGGGG + Intergenic
921155778 1:212437436-212437458 TCCCACAGCAGAAACTCTTGGGG - Intronic
923097433 1:230786854-230786876 TTCCACACCACATAACATAGGGG - Intronic
924037308 1:239950415-239950437 CCCCACACCACGTATCCTTGTGG + Intergenic
1068093401 10:52460423-52460445 TCCCCCTCCCCATAATATTGAGG + Intergenic
1069856783 10:71445366-71445388 TCACACACCAAATCGTCTTGTGG + Intronic
1069907858 10:71742351-71742373 TGCCACACCACACAATGTAGGGG - Intronic
1070696154 10:78564707-78564729 GCACACACCAAAAAATCTTGAGG + Intergenic
1074286419 10:112102036-112102058 TACCACAAAACATAATCCTGTGG - Intergenic
1075551733 10:123397578-123397600 AGCCACACCGAATAATCTTGGGG + Intergenic
1075651254 10:124129359-124129381 CCCCACTCCACACACTCTTGGGG + Intergenic
1079959024 11:26899878-26899900 TCCCACAACAAATAATGATGGGG - Intergenic
1086199019 11:84178088-84178110 TCCCACCCCACAAAATTCTGTGG + Intronic
1090065117 11:123497134-123497156 CCCCAAACCAAATAATGTTGTGG + Intergenic
1090762788 11:129851652-129851674 TCCCACCCTACATATTCTTTAGG + Intronic
1095923559 12:47555950-47555972 TCCAACACTGCACAATCTTGGGG + Intergenic
1095940716 12:47725037-47725059 CCCCAGACAACAAAATCTTGGGG + Intronic
1099472480 12:83068522-83068544 TCCCACATCACAGAAGCTTGTGG - Intronic
1100358388 12:93853727-93853749 TCCCAGAACACGTACTCTTGTGG - Intronic
1101625938 12:106441580-106441602 TCACACACCACATAACATTTTGG - Intronic
1101946829 12:109143753-109143775 TCCCACATCAAAGAATCTTCAGG + Intronic
1102404082 12:112657665-112657687 TCACATACCACATAATGTTTAGG - Intronic
1102617642 12:114168624-114168646 AACCACACCACACGATCTTGAGG + Intergenic
1105281310 13:18964317-18964339 TCCCACATTACATAGTTTTGAGG + Intergenic
1105290524 13:19050332-19050354 TCCCACATTACATAGTTTTGAGG + Intergenic
1107079476 13:36359221-36359243 CCCCACTCCATATAATTTTGTGG - Intronic
1107373160 13:39773975-39773997 GCCCACACCACATACTCCTATGG - Intronic
1107835706 13:44410967-44410989 TCCCACATCTCATAACTTTGAGG + Intergenic
1110025799 13:70537869-70537891 TCCCATACCACATCAGCTAGGGG + Intergenic
1116473710 14:45315671-45315693 TCCAACTCCACTTAAGCTTGTGG - Intergenic
1116670328 14:47833087-47833109 TAAGACACCACATAATCTTTTGG - Intergenic
1119040144 14:71267190-71267212 GCCCACACAAGAAAATCTTGAGG - Intergenic
1119862041 14:77943099-77943121 TGCCACACCACTGAATCTTGTGG + Intergenic
1126465022 15:48954127-48954149 TCCCACAACACAGAATTGTGAGG - Intronic
1127460227 15:59191996-59192018 CCCTACACCTCATAAACTTGTGG + Intronic
1128118548 15:65128952-65128974 TCCCACCCCAAATATTATTGAGG - Intronic
1129098644 15:73236850-73236872 GCCCACACCACATAAGGGTGTGG - Intronic
1132439342 15:101842978-101843000 TCCCAGACCACATGATCTTCAGG - Intergenic
1133054383 16:3138306-3138328 TCCCACACCCCAGCATCCTGAGG + Intronic
1135266458 16:21030555-21030577 TCCCAGCCCACAAAATCATGAGG + Intronic
1136940376 16:34519124-34519146 TCCCACAACAAAGAATCTTCTGG - Intergenic
1136959443 16:34829446-34829468 TCCCACAACAAAGAATCTTCTGG + Intergenic
1136967628 16:34933815-34933837 TCCCACAACAAAGAATCTTCTGG + Intergenic
1143770214 17:9163793-9163815 CCCCACCCCACAAAATCTTTTGG + Intronic
1147747777 17:42705965-42705987 CCCCACACCACATAAAATGGAGG - Intronic
1149871390 17:60185048-60185070 ACCCACTGCACATAATCATGTGG - Intronic
1152119981 17:78412634-78412656 TCCTAGACCACAGAATCTGGTGG - Intronic
1152589188 17:81203060-81203082 TCCACCACCACATGGTCTTGCGG - Intronic
1152633878 17:81422686-81422708 TCCCACACCACATCAGGTGGGGG - Intronic
1157474860 18:48016883-48016905 TCCCACACCACAGTATTCTGAGG - Intergenic
1166271883 19:41719545-41719567 TCCCACACCACCCAACCGTGGGG - Intronic
1166296044 19:41890054-41890076 TCCCTCACCTCATCAGCTTGTGG + Intronic
1168545367 19:57245332-57245354 TCCCTGACCACCGAATCTTGGGG + Intronic
925449360 2:3954742-3954764 TCCCTCTCCAAATCATCTTGGGG + Intergenic
929522677 2:42668467-42668489 TCCCACATGACATCAACTTGAGG + Intronic
938777641 2:134555871-134555893 ACCCAAATCACATAGTCTTGAGG - Intronic
940963756 2:159814775-159814797 TCCCACAACATATAAATTTGGGG - Intronic
941324729 2:164099624-164099646 TCCCACAGCAAAGAATCATGTGG - Intergenic
943473947 2:188331605-188331627 TATAACAACACATAATCTTGTGG + Intronic
944148908 2:196536674-196536696 TCACACAGCAAATAATCTTCAGG + Intronic
948195395 2:236092018-236092040 TCCTACAGCACGTAATCTTTTGG - Intronic
1169461281 20:5797961-5797983 TTCCACACCACTAAATTTTGGGG - Intronic
1174693320 20:52531586-52531608 TCCCATATCACATATTCTTATGG - Intergenic
1176585158 21:8576591-8576613 TCCCACAACAAATAATCCTCTGG + Intergenic
1179637371 21:42721837-42721859 TCCCACCCCCCACAATCTTCCGG + Intronic
1179972123 21:44841981-44842003 TCACACACCACATAAGATTTTGG - Intergenic
1180002287 21:45000725-45000747 CCCCATACCGCAGAATCTTGGGG + Intergenic
1180267967 22:10553491-10553513 TCCCACAACAAATAATCCTCTGG + Intergenic
1182371545 22:29814695-29814717 TACCACACCCCAGAAGCTTGAGG - Exonic
1203323600 22_KI270737v1_random:93968-93990 TCCCACAACACAGAATCCTCTGG - Intergenic
949247200 3:1939208-1939230 TCCCACACCACAGTGTATTGAGG + Intergenic
949837119 3:8281092-8281114 ACCCACAGCACATGATTTTGTGG - Intergenic
954270121 3:49501461-49501483 TCCCACAACTTATAGTCTTGTGG + Intronic
958873058 3:99584010-99584032 GGCCAGTCCACATAATCTTGGGG - Intergenic
961735017 3:128995876-128995898 TCCCCTCCCACATAATCTTCCGG + Intronic
962775848 3:138659015-138659037 TCCCACATCACATTCTCTTTTGG + Intronic
963565542 3:146925090-146925112 TCCCAAAACACATTGTCTTGTGG + Intergenic
965074573 3:163959889-163959911 TGCCAAAACACATAATCTAGGGG + Intergenic
966527663 3:180938086-180938108 ATCCACACCAAATAATTTTGAGG - Intronic
968876772 4:3272898-3272920 TCCAACACCACATGGTCCTGGGG + Intergenic
972970035 4:44563200-44563222 TACAACACCTTATAATCTTGAGG + Intergenic
973996345 4:56463184-56463206 TCCCACACCTCAAATACTTGGGG + Intergenic
975192457 4:71481140-71481162 TCCCACACCACATAATCTTGAGG - Intronic
975343109 4:73263243-73263265 TCCCACTCCCCATCAACTTGAGG + Intergenic
975746613 4:77481261-77481283 TCCCACAGAACATAATCCTATGG - Intergenic
979963244 4:127046586-127046608 TTCAACACCTCATAATCTGGGGG - Intergenic
980747746 4:137041770-137041792 TTCCAATCCACATAATCATGAGG + Intergenic
981585332 4:146295294-146295316 TCCCACCCCACCTAACCTTCAGG - Intronic
984031407 4:174608747-174608769 TACCACAACCCATAATCTTCTGG + Intergenic
984473499 4:180208233-180208255 TCCCACACATAATAATCATGTGG - Intergenic
992212516 5:74494755-74494777 TCCCACTCCAGATAAGCATGGGG + Intergenic
993484098 5:88461193-88461215 TCTCACACAACATAATTATGAGG - Intergenic
999458519 5:151737966-151737988 TCCCACATGGCACAATCTTGAGG + Intergenic
1000179337 5:158792675-158792697 CCCCAGACCACATGATCTTGAGG - Intronic
1003139931 6:3462686-3462708 TCGCACACCCCATAATTGTGTGG - Intergenic
1007571257 6:42892522-42892544 TCACTCACCACCTAGTCTTGAGG + Intergenic
1008437763 6:51496204-51496226 ACCCACACCACATTACCATGAGG - Intergenic
1010134565 6:72535612-72535634 CTCTACACCACCTAATCTTGAGG - Intergenic
1013466861 6:110425419-110425441 TTCCAGACCCCAGAATCTTGTGG + Intronic
1020392149 7:7669672-7669694 TCCCACAGAACAACATCTTGAGG + Intronic
1022624549 7:32021248-32021270 TTCCACACAACAAAATCTTTGGG - Intronic
1022828031 7:34036586-34036608 CCACACACCACACAATCTAGGGG + Intronic
1031692693 7:124809999-124810021 TTCCAGACATCATAATCTTGAGG - Intergenic
1032072279 7:128815601-128815623 TCCCACCCCACAGAGTCTGGAGG + Exonic
1035076943 7:156185878-156185900 TCCCACCCCACTTAATTTTATGG + Intergenic
1040573589 8:48630814-48630836 TCCAACACGACTTAATTTTGTGG + Intergenic
1044074538 8:87802947-87802969 TCACGCACCACATAATCTTTTGG + Intergenic
1047560652 8:125984728-125984750 TCCCCCAACACATAAACTTTGGG + Intergenic
1058094230 9:100840620-100840642 TTCCATGTCACATAATCTTGAGG + Intergenic
1187399260 X:18945142-18945164 TCCCACATTCCATAATCCTGGGG + Exonic
1188817991 X:34739116-34739138 TCCAAGACCACAGCATCTTGAGG - Intergenic
1192197849 X:69041877-69041899 TCACACACTACATAACCATGTGG + Intergenic
1192757994 X:74066292-74066314 ACACACACAACATAATCTAGTGG - Intergenic
1194268619 X:91782575-91782597 TCCCCCACCTCACAATTTTGTGG - Intronic
1194279952 X:91938403-91938425 TTCCACAGCTCACAATCTTGAGG + Intronic
1194753871 X:97714361-97714383 TCACACATCAGATAATCTGGAGG - Intergenic
1195757501 X:108213778-108213800 TCCCACATCAGACAATATTGAGG - Intronic
1197945911 X:131840128-131840150 TCCCAGACCACAGAATCAAGGGG + Intergenic
1198325345 X:135565775-135565797 TCCCACACCAGAAACTCTGGAGG + Intronic
1200585819 Y:5003490-5003512 TCCCCCACCTCACAATTTTGTGG - Intronic
1200597430 Y:5161904-5161926 TTCCACAGCTCACAATCTTGAGG + Intronic
1201412225 Y:13711481-13711503 TCACAAACAACATAATCTTAAGG + Intergenic