ID: 975192463

View in Genome Browser
Species Human (GRCh38)
Location 4:71481172-71481194
Sequence CACTATGCTCAGAAGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975192457_975192463 9 Left 975192457 4:71481140-71481162 CCTCAAGATTATGTGGTGTGGGA 0: 1
1: 0
2: 0
3: 5
4: 123
Right 975192463 4:71481172-71481194 CACTATGCTCAGAAGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975192463 Original CRISPR CACTATGCTCAGAAGGTGCT GGG Intronic
No off target data available for this crispr