ID: 975192463 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:71481172-71481194 |
Sequence | CACTATGCTCAGAAGGTGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
975192457_975192463 | 9 | Left | 975192457 | 4:71481140-71481162 | CCTCAAGATTATGTGGTGTGGGA | 0: 1 1: 0 2: 0 3: 5 4: 123 |
||
Right | 975192463 | 4:71481172-71481194 | CACTATGCTCAGAAGGTGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
975192463 | Original CRISPR | CACTATGCTCAGAAGGTGCT GGG | Intronic | ||
No off target data available for this crispr |