ID: 975193760

View in Genome Browser
Species Human (GRCh38)
Location 4:71498197-71498219
Sequence ACTACGGCATTCATCATTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975193760_975193763 2 Left 975193760 4:71498197-71498219 CCCGTAATGATGAATGCCGTAGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 975193763 4:71498222-71498244 AGAGAAACAGATAATTAAACTGG 0: 1
1: 0
2: 5
3: 52
4: 657
975193760_975193764 3 Left 975193760 4:71498197-71498219 CCCGTAATGATGAATGCCGTAGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 975193764 4:71498223-71498245 GAGAAACAGATAATTAAACTGGG 0: 1
1: 0
2: 4
3: 44
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975193760 Original CRISPR ACTACGGCATTCATCATTAC GGG (reversed) Intronic
909956997 1:81790634-81790656 ACAATGGTATTCATCATTATAGG + Intronic
1063990518 10:11556649-11556671 ACTTAGGCAATAATCATTACAGG + Intronic
1064180803 10:13112837-13112859 ACTACAGCTTTCATCATAAAAGG - Intronic
1066639963 10:37546023-37546045 GCTATAGCATTCATCATCACAGG - Intergenic
1074951337 10:118340099-118340121 ACTGTACCATTCATCATTACAGG + Intronic
1076591196 10:131584689-131584711 CCTACAGCATTCACCATCACAGG - Intergenic
1083052377 11:59788792-59788814 ACTACAGCAATCATCATCAGAGG - Intronic
1092570633 12:9717284-9717306 ATTACGGCCATCATCATTATAGG - Intronic
1098951967 12:76648761-76648783 ACTATCGCATTCACCACTACCGG - Intergenic
1099919275 12:88937193-88937215 ACCAGGGCATTCATTATTATAGG + Intergenic
1105711948 13:23019073-23019095 ACAACGGGAATCATCCTTACTGG - Intergenic
1119993319 14:79224789-79224811 ATTTCTGCCTTCATCATTACTGG - Intronic
1147616460 17:41831459-41831481 ACCACAGCAATCATCATCACTGG - Intronic
1150602977 17:66666541-66666563 ACTACTGGATTCATCAATATTGG - Intronic
1165851230 19:38851391-38851413 CCTACGGCATTTAACATTATGGG + Intronic
929262741 2:39883802-39883824 ACCACTGCATTCTTTATTACTGG - Intergenic
940466955 2:154043098-154043120 ACTACTGCTGTCATCATCACAGG - Intronic
943963322 2:194296635-194296657 ACTACTGCAGTTAGCATTACTGG - Intergenic
1168825272 20:808104-808126 ACTAAGTCATTCATAATTATAGG - Intergenic
1169177288 20:3528410-3528432 ACAACTGCATTCATTTTTACAGG - Intronic
1179115467 21:38487671-38487693 GCTCCAGCATTCATCCTTACAGG - Intronic
1184220038 22:43094226-43094248 ACTACAGCAGTCATCGTCACTGG + Intergenic
958097335 3:88963574-88963596 ATTACGGTATTCATCATGCCAGG - Intergenic
962092717 3:132262034-132262056 AATAGGGGATTCATCATTCCAGG - Intronic
975193760 4:71498197-71498219 ACTACGGCATTCATCATTACGGG - Intronic
980246472 4:130251117-130251139 ACTACAGCATTCAAAATTACAGG + Intergenic
982335007 4:154225439-154225461 ACAACCTAATTCATCATTACAGG + Intergenic
1000710406 5:164568225-164568247 ATTACAGCATTCATAACTACTGG + Intergenic
1021496753 7:21283489-21283511 AACACTGTATTCATCATTACTGG - Intergenic
1024447588 7:49499535-49499557 ACTGCGGCAGTCATTATTATGGG - Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1039702422 8:39975873-39975895 GCTTTGACATTCATCATTACTGG - Intronic
1045267222 8:100629987-100630009 ACTACAGCCTTTATCATTAAGGG - Intronic
1053427447 9:38019812-38019834 ACTACTGCATCCATCAATAGAGG + Intronic
1053812323 9:41866066-41866088 ACTAGGGCCTTTATGATTACTGG - Intergenic
1054618272 9:67321373-67321395 ACTAGGGCCTTTATGATTACTGG + Intergenic
1060566354 9:124595884-124595906 ACTACGACAGTCATCCTCACAGG + Intronic
1186608199 X:11112672-11112694 ACTACCTCAATCATCATGACAGG - Intronic
1189801825 X:44698612-44698634 ACTGCGGCTTTCATCATCATTGG + Intergenic
1193997381 X:88383358-88383380 ACCACAGCATTTACCATTACCGG - Intergenic