ID: 975197394

View in Genome Browser
Species Human (GRCh38)
Location 4:71541642-71541664
Sequence TGACCCCATCAAGCCCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975197394_975197401 26 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197401 4:71541691-71541713 GCAGCAGTGAGGATGGATGGGGG No data
975197394_975197398 23 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197398 4:71541688-71541710 CTGGCAGCAGTGAGGATGGATGG 0: 1
1: 0
2: 4
3: 76
4: 506
975197394_975197400 25 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197400 4:71541690-71541712 GGCAGCAGTGAGGATGGATGGGG No data
975197394_975197399 24 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197399 4:71541689-71541711 TGGCAGCAGTGAGGATGGATGGG 0: 1
1: 0
2: 5
3: 62
4: 451
975197394_975197396 15 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197396 4:71541680-71541702 CACTCAGTCTGGCAGCAGTGAGG 0: 1
1: 0
2: 3
3: 42
4: 312
975197394_975197397 19 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197397 4:71541684-71541706 CAGTCTGGCAGCAGTGAGGATGG 0: 1
1: 0
2: 5
3: 48
4: 447
975197394_975197395 4 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197395 4:71541669-71541691 TGCATTTGAAACACTCAGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 160
975197394_975197402 29 Left 975197394 4:71541642-71541664 CCAGCTTGGGCTTGATGGGGTCA 0: 1
1: 0
2: 1
3: 18
4: 134
Right 975197402 4:71541694-71541716 GCAGTGAGGATGGATGGGGGAGG 0: 1
1: 0
2: 11
3: 92
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975197394 Original CRISPR TGACCCCATCAAGCCCAAGC TGG (reversed) Intronic