ID: 975200704

View in Genome Browser
Species Human (GRCh38)
Location 4:71584714-71584736
Sequence GATTAAGGCTGAAGCTTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975200704_975200706 28 Left 975200704 4:71584714-71584736 CCTGCTAAGCTTCAGCCTTAATC No data
Right 975200706 4:71584765-71584787 TTTAGCAGAAGCATGTCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975200704 Original CRISPR GATTAAGGCTGAAGCTTAGC AGG (reversed) Intergenic
No off target data available for this crispr