ID: 975201900

View in Genome Browser
Species Human (GRCh38)
Location 4:71600758-71600780
Sequence AAATTGTAACACATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975201900_975201901 16 Left 975201900 4:71600758-71600780 CCTGGGGAAATGTGTTACAATTT No data
Right 975201901 4:71600797-71600819 AAAAGTCAAAAGTCTTCTGCTGG No data
975201900_975201902 19 Left 975201900 4:71600758-71600780 CCTGGGGAAATGTGTTACAATTT No data
Right 975201902 4:71600800-71600822 AGTCAAAAGTCTTCTGCTGGTGG No data
975201900_975201903 26 Left 975201900 4:71600758-71600780 CCTGGGGAAATGTGTTACAATTT No data
Right 975201903 4:71600807-71600829 AGTCTTCTGCTGGTGGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975201900 Original CRISPR AAATTGTAACACATTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr