ID: 975207716

View in Genome Browser
Species Human (GRCh38)
Location 4:71663692-71663714
Sequence GTACAATCAGGGCCTAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975207716_975207719 7 Left 975207716 4:71663692-71663714 CCACTTCTAGGCCCTGATTGTAC No data
Right 975207719 4:71663722-71663744 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
975207716_975207720 19 Left 975207716 4:71663692-71663714 CCACTTCTAGGCCCTGATTGTAC No data
Right 975207720 4:71663734-71663756 TTTTTTTTTGGAAAAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975207716 Original CRISPR GTACAATCAGGGCCTAGAAG TGG (reversed) Intergenic
No off target data available for this crispr