ID: 975210091

View in Genome Browser
Species Human (GRCh38)
Location 4:71689885-71689907
Sequence ATGTACCAATATAAGACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975210088_975210091 11 Left 975210088 4:71689851-71689873 CCACGGAATCATCGAAGTCATGG No data
Right 975210091 4:71689885-71689907 ATGTACCAATATAAGACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975210091 Original CRISPR ATGTACCAATATAAGACCTA TGG Intergenic
No off target data available for this crispr