ID: 975211004

View in Genome Browser
Species Human (GRCh38)
Location 4:71699899-71699921
Sequence CTTCAGACCTAGACTTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975211001_975211004 20 Left 975211001 4:71699856-71699878 CCTTTCTTCTCTCATCTGTACAC No data
Right 975211004 4:71699899-71699921 CTTCAGACCTAGACTTATCATGG No data
975211000_975211004 21 Left 975211000 4:71699855-71699877 CCCTTTCTTCTCTCATCTGTACA No data
Right 975211004 4:71699899-71699921 CTTCAGACCTAGACTTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975211004 Original CRISPR CTTCAGACCTAGACTTATCA TGG Intergenic
No off target data available for this crispr