ID: 975217149

View in Genome Browser
Species Human (GRCh38)
Location 4:71768999-71769021
Sequence TGCTCTGTACCTCATTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 500}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975217143_975217149 18 Left 975217143 4:71768958-71768980 CCAATCTGGTGTTGTCCTTCTTA 0: 1
1: 0
2: 2
3: 17
4: 175
Right 975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG 0: 1
1: 0
2: 1
3: 50
4: 500
975217142_975217149 26 Left 975217142 4:71768950-71768972 CCATCAAACCAATCTGGTGTTGT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG 0: 1
1: 0
2: 1
3: 50
4: 500
975217146_975217149 -10 Left 975217146 4:71768986-71769008 CCCCAAATGTACTTGCTCTGTAC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG 0: 1
1: 0
2: 1
3: 50
4: 500
975217145_975217149 -7 Left 975217145 4:71768983-71769005 CCTCCCCAAATGTACTTGCTCTG 0: 1
1: 1
2: 3
3: 8
4: 159
Right 975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG 0: 1
1: 0
2: 1
3: 50
4: 500
975217144_975217149 3 Left 975217144 4:71768973-71768995 CCTTCTTAAGCCTCCCCAAATGT 0: 1
1: 0
2: 8
3: 215
4: 3506
Right 975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG 0: 1
1: 0
2: 1
3: 50
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975217149 Original CRISPR TGCTCTGTACCTCATTGCCT TGG Intronic
901675124 1:10878798-10878820 TGCTTTGGAACTCATTTCCTAGG - Intergenic
902447443 1:16476158-16476180 GGCCCTGTCCCTCATTGCCTGGG - Intergenic
902467295 1:16626108-16626130 GGCACTGTCCCTCATTCCCTGGG - Intergenic
902507290 1:16946636-16946658 GGCACTGTCCCTCATTCCCTGGG + Intronic
902698205 1:18154574-18154596 TGCCCTGGGCCTCCTTGCCTGGG - Intronic
902968246 1:20027937-20027959 TGCTGTGTATCTCATTTCTTAGG + Intergenic
903595370 1:24490075-24490097 TGCCAAGTCCCTCATTGCCTCGG - Intergenic
906869344 1:49460213-49460235 TGCTATCTACCTCATTTCTTAGG + Intronic
907516486 1:54996503-54996525 TGCTCTTTCCCTCCCTGCCTCGG + Intergenic
908888585 1:68817827-68817849 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
909217577 1:72910092-72910114 TGTTCTGAATGTCATTGCCTAGG + Intergenic
909904570 1:81178852-81178874 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
910609757 1:89128286-89128308 TGCTAAGTCCCTCATTGCCCAGG + Intronic
910919370 1:92327283-92327305 TGCTTTCTATCTCATTTCCTAGG + Intronic
911150714 1:94594885-94594907 TGCTCTGCACCTCCTTCCGTGGG + Intergenic
911305239 1:96224583-96224605 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
911360558 1:96871139-96871161 TGCTGTCTACCTCATTTCTTCGG + Intergenic
911743478 1:101413106-101413128 TGCTGTCTACCTCATTTCTTAGG - Intergenic
911839254 1:102660257-102660279 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
912058128 1:105631480-105631502 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
912121461 1:106476840-106476862 TGCTATGTATCTCATTTCTTAGG - Intergenic
913178651 1:116298228-116298250 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
915104125 1:153521902-153521924 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
916219861 1:162433268-162433290 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
916910115 1:169337322-169337344 TGCTAAGTCCCTCATTGCCCAGG + Intronic
916960279 1:169882226-169882248 TGCTAAGCACCTCATTGCCCCGG - Intronic
917860512 1:179138962-179138984 TGCTAAGTCCCTCATTGCCCGGG - Intronic
917933002 1:179837175-179837197 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
919091898 1:192987026-192987048 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
919525337 1:198641599-198641621 TGCTCTGTGCCTCTTTGCCATGG + Intronic
920731374 1:208488683-208488705 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
921897094 1:220412547-220412569 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
922056822 1:222049861-222049883 TGCTAAGCTCCTCATTGCCTGGG - Intergenic
922541917 1:226426537-226426559 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
922855789 1:228773820-228773842 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
922995730 1:229958275-229958297 TGCTGTCTACCTCATTTCTTAGG + Intergenic
923157237 1:231289720-231289742 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
923324815 1:232871689-232871711 TGCTAAGTTCCCCATTGCCTGGG + Intergenic
1063322181 10:5060887-5060909 TGCTAAGTCCCTCACTGCCTGGG + Intronic
1064790363 10:18951523-18951545 TGCTAAGTCCCTTATTGCCTGGG + Intergenic
1064805656 10:19128292-19128314 AGCTCTGTGTGTCATTGCCTGGG + Exonic
1067002765 10:42632968-42632990 TACTCTGTAACCCATTTCCTTGG - Intronic
1067466030 10:46499636-46499658 TGCTCTGTGCCTCATCACCATGG - Intergenic
1067621158 10:47884970-47884992 TGCTCTGTGCCTCATCACCATGG + Intergenic
1067662885 10:48249742-48249764 TGTTCTGGACCTTAATGCCTAGG + Intronic
1068122641 10:52799283-52799305 TGCTGTGTATCTCATTTCTTAGG + Intergenic
1068157206 10:53215539-53215561 TGCTCTCTATCTCATTTCTTAGG + Intergenic
1068863167 10:61867760-61867782 TGCTAAGTCCCTCATTGCCCCGG - Intergenic
1073336666 10:102714856-102714878 TGCTCTGACCCCCATTGCCTAGG + Intronic
1074317145 10:112370426-112370448 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1074986008 10:118660223-118660245 TGCTCTCTATCTCATTTCTTAGG + Intergenic
1075269383 10:121035584-121035606 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1075662227 10:124205890-124205912 TGCTCTCCTCCTCATTGCTTTGG - Intergenic
1077818527 11:5712372-5712394 TCCTCTGTACCACACTGCCATGG + Intronic
1078743699 11:14091572-14091594 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1079199720 11:18365647-18365669 TGCACATTACCTCATTGACTGGG + Intronic
1079726224 11:23883676-23883698 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1080106027 11:28512576-28512598 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1080195200 11:29600391-29600413 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1080203138 11:29697398-29697420 TGCTCTGTATCTCATATCTTAGG + Intergenic
1080557697 11:33431988-33432010 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1081428382 11:42950001-42950023 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1081807219 11:45897121-45897143 TGCTCTGTGCCTCAATTTCTTGG + Intronic
1082104195 11:48202271-48202293 TGCTGTCTATCTCATTTCCTAGG - Intergenic
1084406084 11:68974494-68974516 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1085447250 11:76609274-76609296 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1085543742 11:77297561-77297583 TGCTCTGGAGCTCCTTGCCTAGG + Intronic
1086202868 11:84224464-84224486 AGCTGTGTACATCATTTCCTAGG + Intronic
1086397753 11:86433766-86433788 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1087486395 11:98763655-98763677 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1087616787 11:100494921-100494943 TGCTCTCTATCTCATTTCTTAGG - Intergenic
1087669528 11:101089070-101089092 TGCTCAGTACCTCAGTACCTAGG + Intronic
1087799576 11:102489056-102489078 AGCTCTGCAACCCATTGCCTAGG + Intronic
1088570873 11:111222094-111222116 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1089107602 11:116026160-116026182 TGCTGTGTACCTCATTTCTTAGG - Intergenic
1089169555 11:116502654-116502676 AGCTCTGTGCTTCCTTGCCTGGG - Intergenic
1089261357 11:117226021-117226043 TGCTGTGGCCTTCATTGCCTAGG - Exonic
1089373578 11:117978732-117978754 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1090022234 11:123138098-123138120 AGCTCTGTCCCTAATTCCCTCGG + Intronic
1090894798 11:130962330-130962352 TGCTGTGTATCTCATTCCTTAGG + Intergenic
1091182590 11:133620154-133620176 TGGTGTGTTCCTCATTGGCTGGG - Intergenic
1091233456 11:134003107-134003129 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1091293330 11:134454725-134454747 TGCTCTGTACCTGATCACCGAGG + Intergenic
1092135197 12:6142312-6142334 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1092967078 12:13654531-13654553 TGTTCTGTATATCATTGCATTGG - Intronic
1092990371 12:13891475-13891497 TGGTGTGAACCTCATTGCATTGG - Intronic
1093652546 12:21661645-21661667 TGCTAAGCCCCTCATTGCCTGGG - Intronic
1093972957 12:25391544-25391566 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1094666483 12:32525789-32525811 TGCTAAGTCCCCCATTGCCTGGG - Intronic
1095123090 12:38442064-38442086 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1096998736 12:55857841-55857863 TGCTCTCAAACTCCTTGCCTTGG + Intergenic
1097385741 12:58948361-58948383 TGCTGTCTATCTCATTGCTTAGG + Intergenic
1098588665 12:72185161-72185183 TGCTAAGTCCCTCATTGCCCGGG - Intronic
1098654523 12:73011182-73011204 TGCTGTCTACCTCATTTCTTAGG + Intergenic
1098759237 12:74403062-74403084 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1099228165 12:79993469-79993491 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1099478665 12:83140235-83140257 TGCTAAGCTCCTCATTGCCTGGG - Intergenic
1099523941 12:83696531-83696553 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1100158933 12:91834856-91834878 TGGTCTGTTCCACAGTGCCTGGG - Intergenic
1104582634 12:130022170-130022192 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1104614521 12:130256899-130256921 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1104749233 12:131227927-131227949 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1105477394 13:20740172-20740194 TGCTAAGTCCCTCACTGCCTGGG + Intronic
1106149912 13:27089312-27089334 TGATATGTACCTCATGGCCCCGG - Intronic
1106221333 13:27748559-27748581 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1106643437 13:31609072-31609094 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1106810943 13:33358096-33358118 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1107259387 13:38472675-38472697 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1107590470 13:41898824-41898846 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1108099184 13:46936300-46936322 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1108134561 13:47341290-47341312 TGCTCTCTATCTCATTTCTTAGG - Intergenic
1108751538 13:53452638-53452660 TGCTAAGTCCCTCATTGCCCTGG + Intergenic
1109077263 13:57852391-57852413 TGCTCTTATCCTCATTGCCAAGG - Intergenic
1109159878 13:58958427-58958449 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1109446617 13:62448144-62448166 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1110368861 13:74718507-74718529 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1111456316 13:88488508-88488530 AGCTGTGTTCCTGATTGCCTAGG + Intergenic
1111748320 13:92296781-92296803 TGCTAAGTCCCTCATTGCCCGGG - Intronic
1112533174 13:100224294-100224316 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1113482689 13:110633274-110633296 TGCTAAGTCCCTCATTGCCCCGG + Intronic
1113506633 13:110821275-110821297 TGCTAAGTCCCTCATTGCCCCGG - Intergenic
1113678049 13:112221832-112221854 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1113845413 13:113386433-113386455 TGCTGTGTATCTCATTTCTTTGG + Intergenic
1114593529 14:23891872-23891894 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
1116251039 14:42482636-42482658 TGCTAAGTCCCTCATTGCCCTGG + Intergenic
1116995166 14:51315875-51315897 ACCTCAGCACCTCATTGCCTTGG + Intergenic
1118215374 14:63803509-63803531 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1119160958 14:72452133-72452155 TGCTTTGTTCTTCATTTCCTGGG + Intronic
1119497966 14:75097170-75097192 ATATCTGTACCTCATGGCCTCGG - Exonic
1119673455 14:76536995-76537017 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1119870708 14:78014226-78014248 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1120439117 14:84513154-84513176 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1120844159 14:89111763-89111785 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1121350667 14:93170362-93170384 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
1122493464 14:102135755-102135777 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1123799136 15:23803029-23803051 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1123949135 15:25253438-25253460 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1124610528 15:31204772-31204794 TGCTCTGAGCCTCACAGCCTTGG - Intergenic
1125269188 15:37919568-37919590 TGCTGTCTACCTCATTGCTTAGG + Intergenic
1125609695 15:40961733-40961755 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1125720136 15:41841413-41841435 TGGTCTGCACTTCATTACCTGGG - Intronic
1127007985 15:54592420-54592442 TGCTGTCTACCTCATTTCCTAGG + Intronic
1127014707 15:54670855-54670877 TGCTGTCTATCTCATTTCCTAGG - Intergenic
1127694459 15:61431378-61431400 TGCTGTCTACCTCATTTCTTAGG + Intergenic
1127794489 15:62426409-62426431 AGGTCTGTACCTCAGTGCCTTGG + Intronic
1127898813 15:63326125-63326147 TGCTGGGTGCCTCCTTGCCTTGG - Exonic
1128555400 15:68628299-68628321 TTCTCTGTCCCTTCTTGCCTGGG + Intronic
1128669985 15:69567603-69567625 TGCTAAGTCCTTCATTGCCTGGG + Intergenic
1129280401 15:74480590-74480612 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1129859160 15:78846989-78847011 TGCTAAGTCCCTCATTGCCCAGG - Intronic
1130698886 15:86159014-86159036 CACTCTGTACCTGATTGCTTGGG - Exonic
1130841825 15:87707795-87707817 TACTCTGTGCCTGAATGCCTGGG + Intergenic
1131507781 15:93031943-93031965 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1131972234 15:97904257-97904279 TGCTCAGTGCCTCATCTCCTGGG - Intergenic
1132210069 15:100014986-100015008 TGCTCTCTATCTCATTTCTTAGG + Intronic
1132248285 15:100314860-100314882 TGCTCTTTTTCTCACTGCCTTGG - Intronic
1132253979 15:100358071-100358093 TGCTCTCTATCTCATTTCTTAGG - Intergenic
1133623279 16:7546729-7546751 TTCTTTGTGTCTCATTGCCTGGG + Intronic
1135262127 16:20989885-20989907 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1135589317 16:23693942-23693964 TGATTTTTACCTAATTGCCTGGG - Intronic
1136035707 16:27538305-27538327 GGCCCTGTACCGCATGGCCTGGG + Exonic
1136684544 16:31986506-31986528 TGCTCTGACCCTCTGTGCCTTGG - Intergenic
1136785170 16:32930049-32930071 TGCTCTGACCCTCTGTGCCTTGG - Intergenic
1136884612 16:33923755-33923777 TGCTCTGACCCTCTGTGCCTTGG + Intergenic
1136932320 16:34430450-34430472 TGCTGTCTATCTCATTTCCTAGG + Intergenic
1136972252 16:34981364-34981386 TGCTGTCTATCTCATTTCCTAGG - Intergenic
1137904061 16:52300912-52300934 TACTCTCTTCCTCCTTGCCTTGG - Intergenic
1138066344 16:53945353-53945375 TACTCTGCACCTCTGTGCCTCGG - Intronic
1141816766 16:86415897-86415919 TGCTCTTGTCCTCATTGCCTTGG - Intergenic
1203087830 16_KI270728v1_random:1194058-1194080 TGCTCTGACCCTCTGTGCCTTGG - Intergenic
1143451358 17:7038662-7038684 TGCTCTGGACCACCTTGACTGGG + Exonic
1144201379 17:12945339-12945361 TGCTGTGTAAATCATTTCCTGGG + Intronic
1144740846 17:17581401-17581423 GGCTCTGCTCCTCACTGCCTGGG - Intronic
1145929387 17:28674177-28674199 TGCTCTGCACCTAATGACCTGGG - Intronic
1146404086 17:32522547-32522569 TGCTCTGTGCCTCATCCCCTGGG - Intronic
1146992388 17:37286726-37286748 TCCTCTGGACCTCACTGCCTGGG + Intronic
1147145475 17:38482187-38482209 TGCTCTGACCCTCTGTGCCTCGG - Intronic
1147875216 17:43616233-43616255 TGCTCGCTACCTCTTTGGCTAGG + Intergenic
1148124628 17:45230422-45230444 TGCTCTGTCTCTCTTGGCCTTGG + Intronic
1148408030 17:47437385-47437407 TGCTCTCCACCTCATTTCTTAGG + Intronic
1149258845 17:54857479-54857501 AGCTCTGAACCTGATTACCTTGG - Intergenic
1149307501 17:55363239-55363261 TGCTCTGTGCCTCTGTGCCCTGG - Intergenic
1150691519 17:67371179-67371201 TGCCCTAAACCTCATTTCCTAGG - Intergenic
1150778275 17:68099398-68099420 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1151346762 17:73507179-73507201 TGGTCTGTACCACAGTGCATAGG - Intronic
1151961159 17:77406328-77406350 TTCTCTTTACATCACTGCCTTGG + Intronic
1153644062 18:7178910-7178932 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1155488234 18:26370626-26370648 TGCTTCGTACCTCATTCTCTGGG - Intronic
1156038664 18:32794690-32794712 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1156943162 18:42795348-42795370 TGCTAAGTCCCTCATTGCCCGGG - Intronic
1157887584 18:51383722-51383744 TGCCCTGTACCTTATTCACTGGG + Intergenic
1158956054 18:62540015-62540037 TGCTCTGTAGTCCATTGTCTTGG + Intronic
1159167959 18:64725874-64725896 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1159891579 18:73958303-73958325 TGCCTTGTGTCTCATTGCCTGGG + Intergenic
1159906811 18:74099931-74099953 TGCTGTGTATCTCATTTCTTAGG - Intronic
1162262058 19:9541571-9541593 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1163181727 19:15608889-15608911 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1164144034 19:22499233-22499255 TGCTAAGCCCCTCATTGCCTGGG + Intronic
1164270592 19:23668771-23668793 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1164630079 19:29756229-29756251 TGCTCTGTACCCCACTGCATAGG + Intergenic
1164975788 19:32571704-32571726 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1166487020 19:43222176-43222198 TGCTAAGCCCCTCATTGCCTGGG + Intronic
1167579044 19:50331346-50331368 GGCTCTGTACCGCACTCCCTGGG + Intronic
929070052 2:38020627-38020649 TGCTAAGCCCCTCATTGCCTGGG - Intronic
929201850 2:39244391-39244413 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
930469787 2:51797535-51797557 TGCTGTCTACCTCATTTCTTAGG - Intergenic
930835502 2:55789197-55789219 TGTCCTGAACCTTATTGCCTAGG + Intergenic
930838385 2:55819051-55819073 TGTCCTGAACCTTATTGCCTAGG - Intergenic
932805488 2:74779150-74779172 TTAACTGTACCTCACTGCCTCGG - Intergenic
933487264 2:82938690-82938712 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
933733717 2:85478382-85478404 TGCTCTGCTCCACCTTGCCTGGG + Intergenic
933760120 2:85667049-85667071 TGCTCTGTCCCTCATCTCTTGGG + Intronic
934730633 2:96654456-96654478 TGCTTTGTATCTCATTGCTGAGG - Intergenic
934898488 2:98139119-98139141 TGCTAAGCCCCTCATTGCCTGGG - Intronic
934909917 2:98242286-98242308 TGCTCAATACCTCATTTCCAAGG - Intronic
935000789 2:99012696-99012718 TGCTGTGCATCTCATTTCCTGGG - Intronic
936495349 2:113015667-113015689 GCCTCTGTACCTCAGAGCCTAGG - Intergenic
937061213 2:118981792-118981814 TGCTCTGTTCCTCTTGGCCAGGG - Intronic
937209602 2:120259995-120260017 TGCTAAGTCCCTCATTGCCCGGG + Intronic
937596843 2:123683889-123683911 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
937711855 2:124987654-124987676 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
937746590 2:125422364-125422386 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
939240957 2:139559353-139559375 TGCTCTGTTCCTCAATGGCTTGG - Intergenic
939281746 2:140073905-140073927 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
939465123 2:142546176-142546198 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
939476818 2:142697406-142697428 TGCTGTGTATCTCATTTCCTAGG - Intergenic
939777362 2:146403936-146403958 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
939972549 2:148678645-148678667 TGCTAAGCCCCTCATTGCCTGGG + Intronic
940532909 2:154903440-154903462 TGCTCTCTATCTCATTTCTTAGG + Intergenic
940762615 2:157753627-157753649 TGCTCTCTATCTCATTTCTTAGG - Intronic
940912607 2:159222019-159222041 GGCCCTGTACCTCTGTGCCTTGG + Intronic
941631402 2:167889077-167889099 TGCTGTGTATCTCATTTCTTAGG + Intergenic
941679837 2:168385606-168385628 TGCTGTCTACCTCATTTCTTTGG - Intergenic
943992025 2:194708338-194708360 TCCTCTCTACCTCAGAGCCTTGG - Intergenic
944728592 2:202497026-202497048 TGCTAAGCCCCTCATTGCCTGGG - Intronic
946923575 2:224603946-224603968 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
947411987 2:229850833-229850855 TGCTGAGCCCCTCATTGCCTGGG - Intronic
948159360 2:235811668-235811690 TGCTCTGTACCTCAGGCCATGGG + Intronic
949040836 2:241849423-241849445 TGCTGTGTCCCTCATAGCCCAGG + Intergenic
1169010514 20:2246193-2246215 TTCTCTGCCCCTAATTGCCTGGG - Intergenic
1170057694 20:12224691-12224713 TGCATTGTATCTCATTGCCTTGG - Intergenic
1170649068 20:18223419-18223441 TGTTCAGTAGCTTATTGCCTTGG + Intergenic
1170699281 20:18688855-18688877 TGCTCTGATCCTCATTCCCTGGG + Intronic
1170720805 20:18877214-18877236 TGCTGTCTATCTCATTTCCTAGG + Intergenic
1170777206 20:19386586-19386608 TGCTCTATACCTAATTTTCTGGG + Intronic
1170862925 20:20125841-20125863 TGCTGTCTATCTCATTGCTTAGG + Intronic
1170989878 20:21291987-21292009 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1171318858 20:24220965-24220987 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1171494745 20:25548095-25548117 TGCCCTGTCCCTCCTTGCCATGG + Intronic
1171994372 20:31720918-31720940 GACTTTGCACCTCATTGCCTGGG - Intronic
1172431864 20:34899047-34899069 TGCTAAGCCCCTCATTGCCTGGG + Intronic
1173195533 20:40910714-40910736 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1173195679 20:40911299-40911321 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1173330902 20:42075560-42075582 TCCTTGGTACCTCACTGCCTTGG - Exonic
1173824469 20:46038797-46038819 TCCTCTATACCACACTGCCTTGG + Intronic
1174087475 20:48019397-48019419 TGCCCTTTGACTCATTGCCTAGG + Intergenic
1174128812 20:48327573-48327595 TGCTCTTTGACTCATTGCCTAGG - Intergenic
1174407657 20:50312629-50312651 TGCTCTCTACCCCATTGCCTGGG - Intergenic
1175236541 20:57516776-57516798 TGCTATTTAACTGATTGCCTGGG - Intronic
1175254146 20:57628910-57628932 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
1176589330 21:8627646-8627668 GGCTCTATACCACATAGCCTAGG - Intergenic
1177195306 21:17898428-17898450 TGCTTTATATCTCATTTCCTAGG + Intergenic
1177573077 21:22914354-22914376 TGCTTTGTGCCTGATTGCTTAGG + Intergenic
1177664345 21:24134211-24134233 TAGTCTATACCTCATAGCCTAGG - Intergenic
1179085799 21:38216483-38216505 TGCTCTGTCCCTTAGTGGCTGGG + Intronic
1179798184 21:43797892-43797914 TGCTCTGCCCCTCAGTTCCTTGG + Exonic
1180272158 22:10604643-10604665 GGCTCTATACCACATAGCCTAGG - Intergenic
1181431318 22:22883414-22883436 TGCTCTGTAGCCCCTTCCCTAGG + Intronic
1182917651 22:34049991-34050013 TCTTATGTACCTCCTTGCCTAGG + Intergenic
1183051439 22:35265096-35265118 AGCTCTGTAACTCATGTCCTAGG - Exonic
1184915708 22:47567514-47567536 TTCTCTGGACCTCATGGCCTAGG + Intergenic
949137977 3:594117-594139 GGCTCTATACCACATAGCCTAGG + Intergenic
950133404 3:10563411-10563433 TGCTCTGACCCTCATTGGATGGG + Intronic
950256967 3:11513487-11513509 TGCTAAGCCCCTCATTGCCTGGG + Intronic
950601219 3:14037314-14037336 TGCTAAGCCCCTCATTGCCTGGG - Intronic
951184013 3:19690864-19690886 TGCTGTCTACCTCATTTCTTAGG - Intergenic
953522499 3:43656671-43656693 TGCTAAGTCCCTCATTGCCCGGG + Intronic
953866639 3:46589102-46589124 TGCTGTCTATCTCATTTCCTAGG - Intronic
955210280 3:56934581-56934603 TGCTAAGTCCCTCATTGCCCTGG - Intronic
955265702 3:57441862-57441884 TGTTTTGTACTTTATTGCCTGGG - Intronic
955266465 3:57449590-57449612 TGCTAAGTCCCTCATTGCCCGGG + Intronic
955449478 3:59050974-59050996 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
956481454 3:69677569-69677591 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
956855250 3:73269309-73269331 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
957371479 3:79300335-79300357 TGCTAAGCCCCTCATTGCCTGGG - Intronic
957804913 3:85134105-85134127 TGCTAAGCCCCTCATTGCCTGGG + Intronic
957921527 3:86754908-86754930 TGCTGTGTATCTCATTTCTTAGG + Intergenic
958810759 3:98858168-98858190 TGCTAAGCACCTCACTGCCTGGG + Intronic
960149810 3:114238534-114238556 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
960227541 3:115185131-115185153 TGCTAAGCCCCTCATTGCCTAGG + Intergenic
960756675 3:121021282-121021304 TGCTGTCTATCTCATTGCTTAGG - Intronic
961460457 3:127046793-127046815 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
962065792 3:131979309-131979331 TGCTGTCTATCTCATTTCCTAGG + Intronic
963397205 3:144749928-144749950 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
964367341 3:155964290-155964312 TGCTCTGTGGGTCATTGCTTGGG - Intergenic
964977754 3:162640186-162640208 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
965288036 3:166842928-166842950 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
965482907 3:169242506-169242528 TGCTCCGAACCTCATCCCCTTGG + Intronic
965745636 3:171922294-171922316 TGCTGTCTATCTCATTTCCTAGG - Intronic
965753239 3:171999115-171999137 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
966193780 3:177294402-177294424 TGCTTTGTGGCTCATAGCCTAGG - Intergenic
967441825 3:189517421-189517443 TTCCCTGTTCCTCATTGGCTAGG - Intergenic
967448499 3:189596240-189596262 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
967499160 3:190177293-190177315 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
967646721 3:191933506-191933528 AACTCTGTACCCCATTACCTAGG + Intergenic
968720846 4:2202864-2202886 TGCTGTCTACCTCATTTCTTAGG - Intronic
969288855 4:6225889-6225911 TGCTTTGTATCTCCTGGCCTTGG + Intergenic
970391211 4:15615030-15615052 TGCTAAGTCCCTCATTGCCCAGG - Intronic
971563559 4:28112896-28112918 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
971811950 4:31438768-31438790 TGCTAAGTCCCCCATTGCCTGGG - Intergenic
971852090 4:31996505-31996527 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
972022790 4:34335885-34335907 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
972116764 4:35645474-35645496 AGCTCTGTACCTCTGAGCCTTGG + Intergenic
972392546 4:38627019-38627041 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
973068943 4:45833604-45833626 TGCTATCTACCTCATTTCTTAGG + Intergenic
973308074 4:48675457-48675479 TGCTAAGTCCCTCATTGCCTGGG - Intronic
973544216 4:51964309-51964331 TGTTTTGTAAATCATTGCCTAGG + Intergenic
973787276 4:54343985-54344007 TGCTCTCTATCTCATTTCTTAGG - Intergenic
974012859 4:56623431-56623453 GGCTCTTGGCCTCATTGCCTTGG - Intergenic
974147414 4:57965541-57965563 TGCTGAGTCCCTCATTGCCTGGG - Intergenic
974484794 4:62492140-62492162 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
974641749 4:64640717-64640739 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
974710443 4:65587233-65587255 TCCTCTGTACCTCATGGACCTGG - Intronic
974792774 4:66712658-66712680 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
975034180 4:69660580-69660602 TGCTCTCTATCTCATTGCTTAGG - Intergenic
975217149 4:71768999-71769021 TGCTCTGTACCTCATTGCCTTGG + Intronic
975375164 4:73634918-73634940 TGCTGTCTACCTCATTTCTTAGG - Intergenic
975596370 4:76050901-76050923 TGCTAAGCCCCTCATTGCCTGGG + Intronic
976646874 4:87396190-87396212 TGCTAAGTCTCTCATTGCCTGGG + Intergenic
977750969 4:100609009-100609031 TGCTAAGTCCCTCATTGCCCGGG + Intronic
977906477 4:102483243-102483265 TGCTAAGTCCTTCATTGCCTAGG - Intergenic
978999582 4:115200438-115200460 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
979308315 4:119173902-119173924 TGCTAAGTCCCTCATTGCCCCGG - Intronic
980227974 4:130012897-130012919 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
980384035 4:132063005-132063027 TGCTAAGTCCCTCACTGCCTGGG + Intergenic
980815549 4:137942187-137942209 TGCTAAGTCCCCCATTGCCTGGG - Intergenic
981160248 4:141489065-141489087 TACCATTTACCTCATTGCCTCGG + Intergenic
981176594 4:141690102-141690124 TGCTAAGTCCCTCATTGCCCGGG + Intronic
981275814 4:142897616-142897638 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
982408220 4:155044419-155044441 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
982647669 4:158044286-158044308 TGCTAAGTCCCTCACTGCCTGGG - Intergenic
984692985 4:182749712-182749734 AACTCTGTACCCGATTGCCTGGG - Intronic
985793409 5:1945081-1945103 TTCTCTGTCCCACATTTCCTTGG + Intergenic
986151996 5:5137902-5137924 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
986963587 5:13244305-13244327 TGCTAAGTCCCTCACTGCCTGGG - Intergenic
987876944 5:23691241-23691263 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
988279560 5:29127866-29127888 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
988313725 5:29596032-29596054 TGCTGTCTAGCTCACTGCCTAGG - Intergenic
988902451 5:35747700-35747722 TGCTGTGTATCTCATTTCTTAGG - Intronic
989346792 5:40438776-40438798 TGCTAAGTCCCTCATTGCCCTGG - Intergenic
989957923 5:50376948-50376970 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
989965823 5:50465131-50465153 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
990461519 5:56035606-56035628 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
991558579 5:67924036-67924058 TGCTCTTTTCCTTATTGGCTGGG + Intergenic
991913856 5:71587207-71587229 GGCTCTGTCCCTTATTGGCTGGG + Intergenic
992296735 5:75333802-75333824 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
992496333 5:77297735-77297757 TGGTCTGTTCCACATTGCCTGGG + Intronic
992536045 5:77704621-77704643 TGCTCTGTTTGTGATTGCCTGGG - Intronic
993315442 5:86399481-86399503 TGCTTTTTCTCTCATTGCCTTGG + Intergenic
993320938 5:86466925-86466947 TGCTAAGTCCCTCATTGCCCTGG + Intergenic
993883669 5:93392711-93392733 TGCTGTCTATCTCATTTCCTAGG + Intergenic
993911004 5:93684096-93684118 TTCTCTGTAACTCAGGGCCTAGG + Intronic
994254796 5:97580238-97580260 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
994495655 5:100509161-100509183 TCCTCTGTGCCTCACTTCCTGGG - Intergenic
994509846 5:100689111-100689133 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
994605606 5:101962689-101962711 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
994839854 5:104909274-104909296 TGCTCTGTTGCTCTTTTCCTTGG - Intergenic
995568671 5:113457261-113457283 TGCTAAGTCCCTCATTGCCTGGG - Intronic
995596458 5:113753362-113753384 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
995679874 5:114704532-114704554 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
995920394 5:117304778-117304800 TGCTAAGTCCCCCATTGCCTGGG - Intergenic
996166399 5:120229008-120229030 TGCTCTGTTCCCCATTGTCGAGG + Intergenic
996435687 5:123430664-123430686 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
997893761 5:137697541-137697563 TTCTCTGAACCTCATTGTTTGGG - Intronic
999337727 5:150737131-150737153 TGCTTTGTATCTCATTTCTTAGG - Intronic
999406177 5:151309309-151309331 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1000084734 5:157879398-157879420 TGCTAAGGACCTCACTGCCTGGG - Intergenic
1000329195 5:160194140-160194162 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1002004639 5:176222268-176222290 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1002221738 5:177688352-177688374 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1002868330 6:1144031-1144053 TGCGCTGTACCACAGAGCCTAGG + Intergenic
1003100187 6:3170883-3170905 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1003170852 6:3721008-3721030 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1003271516 6:4611727-4611749 CACCCTGTACCTCATTGTCTAGG - Intergenic
1003591613 6:7441365-7441387 TGCTAAGTTCCTCACTGCCTGGG - Intergenic
1003711758 6:8600684-8600706 TGCTGTCTATCTCATTGCTTAGG + Intergenic
1003736891 6:8887283-8887305 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1003845724 6:10171841-10171863 TGCTAAGTTCCTCATTGCCCAGG - Intronic
1003862786 6:10337528-10337550 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1004005696 6:11635493-11635515 TGGTTTTTACCTCATTGCCAGGG - Intergenic
1004200259 6:13541658-13541680 TGCTAAGCACCTCATTGCCGGGG - Intergenic
1004224392 6:13772606-13772628 TGCTAAGCCCCTCATTGCCTAGG - Intergenic
1004502101 6:16218265-16218287 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1004906939 6:20245014-20245036 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1005059280 6:21761275-21761297 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1005114287 6:22318658-22318680 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1005332884 6:24766179-24766201 TGCTAAGTCCCCCATTGCCTGGG + Intergenic
1005977009 6:30807685-30807707 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1006007820 6:31016918-31016940 TGCTAAGTTCCTCACTGCCTGGG - Intronic
1006033632 6:31195578-31195600 TGCTAAGTCCCTCATTGCCAGGG - Intergenic
1006100655 6:31684151-31684173 TGCTCTGAACCTTATTGCATAGG + Intergenic
1006352636 6:33532507-33532529 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1006372720 6:33655389-33655411 TCCTCTTTAGCTAATTGCCTTGG - Intronic
1006735700 6:36270920-36270942 TGCTCTGTCTCCCAGTGCCTGGG + Intronic
1006748905 6:36364475-36364497 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1007265151 6:40590198-40590220 TGCCCTGCACTTCAGTGCCTTGG - Intergenic
1008038779 6:46774716-46774738 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1008284349 6:49629792-49629814 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1008770992 6:54979353-54979375 TGCCATGTCCCTCATTGCCCGGG - Intergenic
1010458974 6:76091780-76091802 TGCTATGTATCTCATTTCTTAGG + Intergenic
1011319766 6:86078428-86078450 TGCTCTCTATCTCATTTCTTAGG + Intergenic
1012189345 6:96261188-96261210 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1012644180 6:101659096-101659118 TGCTCTGAATCATATTGCCTAGG + Intronic
1012908168 6:105091318-105091340 CGCTCTGGACCTGTTTGCCTGGG - Intergenic
1013410783 6:109881386-109881408 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
1013852430 6:114532556-114532578 TGCTGTCTATCTCATTGCTTAGG + Intergenic
1014718558 6:124892090-124892112 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1014788465 6:125644569-125644591 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1014921077 6:127214833-127214855 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1015600341 6:134904848-134904870 TGCTAAGTTCCTCATTGCCCGGG - Intergenic
1016069893 6:139726591-139726613 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1016092836 6:139999827-139999849 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1016482324 6:144495392-144495414 TGCTAAGTCCCTCATTGCCTGGG + Intronic
1017298979 6:152834461-152834483 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1017537366 6:155363186-155363208 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1018148149 6:160912696-160912718 TCCTTTGTTCCTCATTGTCTTGG + Intergenic
1018624651 6:165765529-165765551 TGCTAAGTCCCTCATTGCCTGGG + Intronic
1019000269 6:168744028-168744050 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1019014458 6:168869805-168869827 TGCCCTGTAACTCAGTGCTTGGG + Intergenic
1019342169 7:513449-513471 GGCTCTGGGCCTCCTTGCCTTGG + Intronic
1019398152 7:834464-834486 TGGTCTGGACATCAGTGCCTGGG + Intronic
1021169688 7:17383822-17383844 TGCTCAGTAATTCATTGACTTGG + Intergenic
1021324118 7:19245601-19245623 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1021466535 7:20950433-20950455 TATTCTGTACCTCATTTCTTTGG + Intergenic
1023192489 7:37597669-37597691 TGCTCTGTACCTGGTGGACTGGG + Intergenic
1024269073 7:47628594-47628616 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1024335642 7:48203156-48203178 TGCTAAGTCCCTCATTGCCTGGG + Intronic
1024455967 7:49607095-49607117 TGCTATCTACCTCATTTCTTAGG - Intergenic
1024465899 7:49711370-49711392 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1024825427 7:53385404-53385426 TGCTAAGTCCCTCATTGCCCCGG + Intergenic
1024938632 7:54739438-54739460 TGCCTTGTTCCTCATTGCCATGG - Intergenic
1025807353 7:64847476-64847498 TGCTGTCTATCTCATTTCCTAGG + Intergenic
1026187094 7:68090657-68090679 TGCTAAGTCCCCCATTGCCTGGG + Intergenic
1026596563 7:71738322-71738344 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1027561664 7:79739417-79739439 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1027564044 7:79768207-79768229 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1027665887 7:81042825-81042847 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
1027667538 7:81057726-81057748 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1027868093 7:83673435-83673457 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1028590470 7:92488034-92488056 TGTTCATTACCACATTGCCTGGG + Intronic
1029567504 7:101348692-101348714 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1030551948 7:110972715-110972737 TGCTCTGTACCTCTCTGGCTTGG - Intronic
1030599986 7:111582186-111582208 TGCTAAGTCCCTCATTGCCCCGG + Intergenic
1031292263 7:119951754-119951776 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1031310076 7:120185328-120185350 TGCTCTGTACTGCATTGCAGTGG + Intergenic
1033968520 7:147008808-147008830 TTCTCTGTACCTTGTTGTCTCGG + Intronic
1034155012 7:148949198-148949220 TGCTAAGTCCCCCATTGCCTGGG - Intergenic
1034167764 7:149038941-149038963 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1035151190 7:156874247-156874269 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1035999237 8:4582944-4582966 TGCTATGTCCCTCATTGCTCAGG - Intronic
1036083751 8:5589884-5589906 TGCACTGTACATAATTGCATGGG + Intergenic
1037241546 8:16784023-16784045 TGCTAAGTCCCCCATTGCCTGGG - Intergenic
1037983520 8:23272233-23272255 TGCTAAGTCCCTCATTGCCCAGG - Intronic
1038639397 8:29311582-29311604 TGCTAAGCCCCTCATTGCCTGGG - Intergenic
1039069119 8:33634076-33634098 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1039284859 8:36028943-36028965 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
1039709498 8:40041667-40041689 TCCTCTGTTCCTCTGTGCCTTGG - Intergenic
1040635453 8:49268403-49268425 TGCTGTCTATCTCATTTCCTAGG + Intergenic
1040952710 8:52953100-52953122 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1041293446 8:56330834-56330856 TGCTGTGTATCTCATTTCTTAGG + Intergenic
1041570326 8:59331022-59331044 TGCTGTGTATCTCATTTCTTAGG + Intergenic
1042673625 8:71292225-71292247 TACTCTATACCTCAGTGGCTAGG + Intronic
1043129943 8:76447857-76447879 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1043701120 8:83290469-83290491 TGCTAAGTCCCTCATTGCCTGGG - Intergenic
1044633481 8:94300577-94300599 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1044880670 8:96719330-96719352 TGCTAAGTTCCTCATTGCCCAGG + Intronic
1045131952 8:99163643-99163665 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1045232333 8:100317018-100317040 TGCTAAGTCCCTCATTGCCCGGG + Intronic
1045467769 8:102485756-102485778 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1045634644 8:104170292-104170314 TGCTATCTATCTCATTTCCTAGG + Intronic
1045671245 8:104555677-104555699 TGCTCTCTATCTCATTTCTTAGG - Intronic
1047982413 8:130196984-130197006 TGCTCTGTATCACAGTACCTTGG - Intronic
1048676970 8:136794044-136794066 TGCTAAGTCCCTCATTGCCCCGG + Intergenic
1049087645 8:140490758-140490780 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1049280657 8:141742497-141742519 TGCTCCTGGCCTCATTGCCTTGG - Intergenic
1050046580 9:1552936-1552958 TCCTTGGTACCTCCTTGCCTAGG + Intergenic
1050920607 9:11196982-11197004 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1051463792 9:17354051-17354073 TGCTAAGTCCCTCATTGCCTGGG - Intronic
1052550053 9:29936831-29936853 TGCTGTGTATCTCATTTCTTAGG + Intergenic
1053547922 9:39042601-39042623 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1053812043 9:41862642-41862664 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1054618552 9:67324797-67324819 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1056422903 9:86446984-86447006 TTCTCTGACCCTGATTGCCTTGG + Intergenic
1056698823 9:88885024-88885046 TGCTGTCTATCTCATTTCCTAGG + Intergenic
1058316432 9:103573011-103573033 TGCACTTTTCCTCATTACCTAGG + Intergenic
1058786489 9:108393630-108393652 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1058799359 9:108530261-108530283 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1059122473 9:111654482-111654504 TGCTCTGTCTCACATTGACTGGG - Intronic
1059748568 9:117226844-117226866 TGCTCAGTACATTATTCCCTGGG + Intronic
1061483820 9:130910238-130910260 TGCTAAGTTCCTCATTGCCCCGG - Intronic
1062601460 9:137320350-137320372 TGCTCCTTCCCTCACTGCCTTGG + Intronic
1203619336 Un_KI270749v1:106232-106254 GGCTCTATACCACATAGCCTAGG - Intergenic
1185643520 X:1601066-1601088 AGCTCTGAACCTCCTTGCATGGG - Exonic
1186124039 X:6393467-6393489 TTCACTGCACCTCATTGCCCTGG + Intergenic
1186323261 X:8452735-8452757 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1186484623 X:9924569-9924591 TGGTCTCTAACTCCTTGCCTCGG + Intronic
1187904006 X:24049808-24049830 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1188162537 X:26820987-26821009 TGCACTGTGCCTCATAGTCTGGG - Intergenic
1189142939 X:38625686-38625708 TGCTCTGGATCTCATCTCCTGGG - Intronic
1189218974 X:39354573-39354595 TGCTGTGTATCTCATTTCTTAGG + Intergenic
1190413975 X:50163575-50163597 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1191100484 X:56721410-56721432 TGCTCTCTACCTCATTTCTTAGG - Intergenic
1192839242 X:74836728-74836750 TGCTGTGAACTGCATTGCCTGGG + Intronic
1192869667 X:75173842-75173864 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1192870574 X:75179762-75179784 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1193040210 X:76996903-76996925 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1193469714 X:81885420-81885442 TGCTTTCTACCTCATTTCTTAGG + Intergenic
1193538166 X:82738448-82738470 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
1193863407 X:86699083-86699105 TGCTGTCTACCTCTTTTCCTAGG - Intronic
1193950923 X:87797182-87797204 TGCTGTCTATCTCATTTCCTAGG - Intergenic
1195258041 X:103107594-103107616 TGCTAAGCCCCTCATTGCCTGGG + Intergenic
1195538781 X:106038850-106038872 TGCTTTGTTCCTCTTGGCCTTGG - Intergenic
1196006334 X:110841403-110841425 TGCTCTGTGCCTAGTTTCCTGGG + Intergenic
1196420820 X:115519328-115519350 TGCTCTGTACATCATGGTCTGGG + Intergenic
1196582686 X:117394797-117394819 TGCTAAGTCCCTCATTGCCCAGG - Intergenic
1196741511 X:119029630-119029652 TGCTAAGTCCCTCATTGCCTGGG - Intergenic
1196827285 X:119751073-119751095 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1197344837 X:125319307-125319329 TGCTAAGTCCCTCATTGCCCAGG + Intergenic
1197571972 X:128161119-128161141 TGCTCTCTATCTCATTTCTTAGG + Intergenic
1198299976 X:135325570-135325592 TGCTACGTCCCTCATTGCCCGGG - Intronic
1198972601 X:142298490-142298512 TGCTAAGCACCTCATTGCCCGGG + Intergenic
1199009952 X:142745968-142745990 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1199028808 X:142972381-142972403 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1199050237 X:143228935-143228957 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1199175529 X:144783748-144783770 TGCTAAGTCCCTCATTGCCCGGG - Intergenic
1199831294 X:151551432-151551454 TGCTAAGTCCCTCATTGCCCGGG + Intergenic
1200824305 Y:7622461-7622483 TGCTAAGTCCCCCATTGCCTGGG + Intergenic
1201423052 Y:13820450-13820472 TGCTAAGTCCCTCATTGCCTGGG + Intergenic
1201488152 Y:14512930-14512952 TGCTATGTCCCTCATTGCCCGGG - Intergenic
1201496942 Y:14598441-14598463 TGCTAAGTCCCCCATTGCCTGGG + Intronic
1201715793 Y:17043222-17043244 TGCTAAGTCCCTTATTGCCTGGG - Intergenic
1201982630 Y:19923961-19923983 TGCTAAGTCCCTCATTGCCCTGG + Intergenic
1202235750 Y:22708626-22708648 TGCTAAGTCCCCCATTGCCTGGG - Intergenic
1202272670 Y:23086004-23086026 TGCTAAGCACCTCACTGCCTGGG + Intergenic
1202293356 Y:23334678-23334700 TGCTAAGCACCTCACTGCCTGGG - Intergenic
1202307413 Y:23487542-23487564 TGCTAAGTCCCCCATTGCCTGGG + Intergenic
1202353417 Y:24018809-24018831 TGCTCTATAATTCCTTGCCTTGG + Intergenic
1202425667 Y:24719748-24719770 TGCTAAGCACCTCACTGCCTGGG + Intergenic
1202445122 Y:24950337-24950359 TGCTAAGCACCTCACTGCCTGGG - Intergenic
1202517362 Y:25651306-25651328 TGCTCTATAATTCCTTGCCTTGG - Intergenic
1202563392 Y:26183044-26183066 TGCTAAGTCCCCCATTGCCTGGG - Intergenic