ID: 975222098

View in Genome Browser
Species Human (GRCh38)
Location 4:71824304-71824326
Sequence CAGCACTAAGAGATGGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975222092_975222098 15 Left 975222092 4:71824266-71824288 CCTAAGTTGAACCAATCAGAGTG No data
Right 975222098 4:71824304-71824326 CAGCACTAAGAGATGGTTTATGG No data
975222094_975222098 4 Left 975222094 4:71824277-71824299 CCAATCAGAGTGAAGGCCCTGAT No data
Right 975222098 4:71824304-71824326 CAGCACTAAGAGATGGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975222098 Original CRISPR CAGCACTAAGAGATGGTTTA TGG Intergenic
No off target data available for this crispr