ID: 975223515

View in Genome Browser
Species Human (GRCh38)
Location 4:71841718-71841740
Sequence CCACCAAAACAGCTCTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975223515_975223519 14 Left 975223515 4:71841718-71841740 CCTTGTAAGAGCTGTTTTGGTGG No data
Right 975223519 4:71841755-71841777 AAACCTGATTGGATGAGTTCAGG No data
975223515_975223518 3 Left 975223515 4:71841718-71841740 CCTTGTAAGAGCTGTTTTGGTGG No data
Right 975223518 4:71841744-71841766 GTTGGAGACAGAAACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975223515 Original CRISPR CCACCAAAACAGCTCTTACA AGG (reversed) Intergenic
No off target data available for this crispr