ID: 975228172

View in Genome Browser
Species Human (GRCh38)
Location 4:71899211-71899233
Sequence CTGTTGAAGGGGTAGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975228172_975228182 13 Left 975228172 4:71899211-71899233 CCCACCATCTACCCCTTCAACAG No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975228172 Original CRISPR CTGTTGAAGGGGTAGATGGT GGG (reversed) Intergenic
No off target data available for this crispr