ID: 975228182

View in Genome Browser
Species Human (GRCh38)
Location 4:71899247-71899269
Sequence TCAAGTCTAAAACATTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975228175_975228182 2 Left 975228175 4:71899222-71899244 CCCCTTCAACAGAACCCCACTGC No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228177_975228182 0 Left 975228177 4:71899224-71899246 CCTTCAACAGAACCCCACTGCCT No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228173_975228182 12 Left 975228173 4:71899212-71899234 CCACCATCTACCCCTTCAACAGA No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228172_975228182 13 Left 975228172 4:71899211-71899233 CCCACCATCTACCCCTTCAACAG No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228171_975228182 14 Left 975228171 4:71899210-71899232 CCCCACCATCTACCCCTTCAACA No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228174_975228182 9 Left 975228174 4:71899215-71899237 CCATCTACCCCTTCAACAGAACC No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228176_975228182 1 Left 975228176 4:71899223-71899245 CCCTTCAACAGAACCCCACTGCC No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data
975228170_975228182 15 Left 975228170 4:71899209-71899231 CCCCCACCATCTACCCCTTCAAC No data
Right 975228182 4:71899247-71899269 TCAAGTCTAAAACATTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975228182 Original CRISPR TCAAGTCTAAAACATTCTGA AGG Intergenic
No off target data available for this crispr