ID: 975231486

View in Genome Browser
Species Human (GRCh38)
Location 4:71939418-71939440
Sequence ATTATTATCATATGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975231486_975231490 28 Left 975231486 4:71939418-71939440 CCCCACACACATATGATAATAAT No data
Right 975231490 4:71939469-71939491 GTCTTATTGACTGATTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975231486 Original CRISPR ATTATTATCATATGTGTGTG GGG (reversed) Intergenic
No off target data available for this crispr