ID: 975240012

View in Genome Browser
Species Human (GRCh38)
Location 4:72046407-72046429
Sequence CAGAGAGAACAAAAGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 304}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975240012_975240016 9 Left 975240012 4:72046407-72046429 CCAGCCGCCTTTTGTTCTCTCTG 0: 1
1: 0
2: 2
3: 23
4: 304
Right 975240016 4:72046439-72046461 CTTGCTTACCCTTCCACAGTGGG No data
975240012_975240020 30 Left 975240012 4:72046407-72046429 CCAGCCGCCTTTTGTTCTCTCTG 0: 1
1: 0
2: 2
3: 23
4: 304
Right 975240020 4:72046460-72046482 GGATATCCCTCACCAGACGCTGG No data
975240012_975240015 8 Left 975240012 4:72046407-72046429 CCAGCCGCCTTTTGTTCTCTCTG 0: 1
1: 0
2: 2
3: 23
4: 304
Right 975240015 4:72046438-72046460 GCTTGCTTACCCTTCCACAGTGG 0: 1
1: 0
2: 2
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975240012 Original CRISPR CAGAGAGAACAAAAGGCGGC TGG (reversed) Intronic
900766526 1:4509631-4509653 CAGAGAGGGCAAAAGGAGCCCGG - Intergenic
900955181 1:5882447-5882469 GAGAAAGAACAAGAGGCGGGGGG - Intronic
901147655 1:7077475-7077497 AAGAGAGAATCAAAGGAGGCTGG - Intronic
901543508 1:9937544-9937566 CAGAAAAAAAAAAAGGCAGCTGG + Intronic
901634976 1:10666324-10666346 CAGAGAGGCCAAGAGGGGGCTGG - Intronic
901748356 1:11389679-11389701 AAAAGAAAACACAAGGCGGCTGG - Intergenic
903838743 1:26223255-26223277 CATAGAGAATAAAGGGCGGACGG - Intergenic
904456493 1:30651357-30651379 CAGGGAGGAGAAAAGCCGGCAGG - Intergenic
904942137 1:34171272-34171294 CAGAGAGAACAAAACACAGAAGG - Intronic
905781035 1:40709506-40709528 CGGAGGAAACAAAAGGCAGCAGG - Intronic
906294384 1:44640373-44640395 CAGAGAGAACTAAAGATGGTAGG - Intronic
910758511 1:90714339-90714361 GAGAGAGACCAAAGGGCAGCTGG - Intronic
911542864 1:99179459-99179481 CAGTAAGAACAAAAGGCTGTGGG + Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
915716770 1:157951511-157951533 GAGAGGGAACAAAAGGAGTCAGG - Intergenic
915801636 1:158799793-158799815 CTGAGAGAAGAAAGGGTGGCTGG + Intergenic
916745058 1:167678792-167678814 CAGGGACAACAAGAGGGGGCGGG - Intronic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
918305230 1:183240017-183240039 CTGAGAGAAGAAAAGGAGCCAGG - Intronic
918430028 1:184449997-184450019 CAGACAGAACACAAGACGGAGGG + Intronic
918633023 1:186741699-186741721 AAGAGAGAACAAAAAGAGGGTGG + Intergenic
920528666 1:206685879-206685901 CAGAGAGAGAAAAAGGAGGGAGG - Intronic
920849803 1:209621074-209621096 GAGAGAGGACAAAAGGGGCCTGG + Intronic
921235964 1:213130680-213130702 CAGAAATAACAAAAGGCTTCTGG - Intronic
923567085 1:235084309-235084331 CAAAGAGGACAAAAGGGCGCTGG + Intergenic
1062988935 10:1796815-1796837 CAGAGAGAATAAAAAGATGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1066574545 10:36810994-36811016 CAGAGAGAACAAAAAGGGGCCGG + Intergenic
1067016938 10:42764249-42764271 AAGAGAGAGCAAAAGGGGGGAGG + Intergenic
1067472595 10:46547635-46547657 GAGAGAGAACAAATGGCTGTGGG - Intergenic
1068406605 10:56598211-56598233 CAGAAAGAAAAAAGGGGGGCGGG - Intergenic
1069374944 10:67784247-67784269 GAGAAAGAAGAAAAGGAGGCAGG + Intergenic
1070206311 10:74266260-74266282 TAGAAAGATCGAAAGGCGGCCGG + Intronic
1071926385 10:90414847-90414869 CAGAAAGAACAAAAGGGGATGGG + Intergenic
1073241049 10:102058381-102058403 CAAAGAGAAGAAAAGACAGCTGG - Intergenic
1074872101 10:117585301-117585323 CAGAGAGATCAAGAAGCAGCTGG - Intergenic
1075287583 10:121200711-121200733 CAGAGAGGAGAAAAGGCAGGGGG + Intergenic
1076209755 10:128630856-128630878 CAGAGAGAACAGAACCCCGCCGG - Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076667280 10:132100401-132100423 GAGAGAGACCCAAAGGCTGCGGG - Intergenic
1078835264 11:15022236-15022258 CAGTGAGAACACATGGCTGCAGG + Intronic
1079098014 11:17523322-17523344 CAGAGAGCACAGAAGGCCCCAGG + Intronic
1079102689 11:17551677-17551699 GAGAGGGAAGAAAAGGAGGCTGG + Intronic
1079305885 11:19321516-19321538 AAGACAGAACAAAAGGAGGGGGG - Intergenic
1080628576 11:34052384-34052406 GAGAGAGAAGAAAAAGCGGGAGG - Intronic
1081281000 11:41209317-41209339 CAGAAAGAAGAAAGGGTGGCAGG - Intronic
1081567071 11:44266564-44266586 CAGGGAGAAGTAAAGGAGGCAGG + Intronic
1081615043 11:44585819-44585841 CAGAGAGAGCAAGAGATGGCAGG - Intronic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1081803582 11:45876670-45876692 CAGAGCTAACAAAAGCCCGCGGG - Intronic
1081992882 11:47347087-47347109 CAGAGAGAACATAAGTCAGTTGG + Intronic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085550901 11:77370419-77370441 TACAGTGAACAAAAGGCAGCAGG - Intronic
1087432011 11:98066689-98066711 CAGAAAGAACAAAAGGGGATGGG - Intergenic
1088230619 11:107670302-107670324 AAGAAAGAACAACAGGGGGCAGG - Intergenic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089113017 11:116072065-116072087 CAGAGAGAACAGATAGAGGCAGG - Intergenic
1089342450 11:117767628-117767650 CAGAGAGTGGAAAAGGCAGCTGG - Intronic
1090029718 11:123196114-123196136 CAGAAAGAACATAAGGCAGAGGG + Intergenic
1090928815 11:131277362-131277384 CAGAGAGAAGAAAAGGCTCAGGG + Intergenic
1091852714 12:3713210-3713232 GTGAGCGAACAAAAGGCGACAGG - Intronic
1091998996 12:5017787-5017809 GAAAGAGAACAAGAGGCGGCGGG - Intergenic
1092538942 12:9407694-9407716 CAGAGAGAAAAGATGGCAGCTGG + Intergenic
1094295745 12:28902300-28902322 GGGAGAGAGCAAAAGGCGGGGGG - Intergenic
1096080419 12:48828941-48828963 CAGACAGAACAGAAGCCGGAGGG - Exonic
1098158671 12:67626127-67626149 CAAAGAGAACAAAAGGGAGGAGG + Intergenic
1098193824 12:67978385-67978407 AAGAGAAAACAAAAGGAGTCAGG - Intergenic
1100913950 12:99396687-99396709 CAGAGTGGAGAAAAGGCGCCAGG + Intronic
1103007885 12:117436279-117436301 CACAGAAAACAAAAGGAGACCGG - Intronic
1104348980 12:128028625-128028647 CACAGAGAAAGAAAGGAGGCTGG + Intergenic
1104914843 12:132259327-132259349 CAGAGGGACTAAAAGGCTGCCGG + Intronic
1105313547 13:19235635-19235657 AAGTGACAACAAAAGGCCGCTGG - Intergenic
1105639197 13:22244716-22244738 CATAGAGAACAAAAAGCAACTGG - Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1106627983 13:31440850-31440872 CAGAGAGTACAAAGGGAGGGGGG - Intergenic
1106977523 13:35238389-35238411 CAGAGAGAATAAAAGACAGGAGG - Intronic
1107740632 13:43446331-43446353 CTGAGAGAACAAAATGAGCCTGG + Intronic
1107827499 13:44342026-44342048 CAGAGAGAACAAAAAGCAGGAGG + Intergenic
1110057408 13:70990919-70990941 CAGTGAGAAGAAAAGAAGGCTGG + Intergenic
1111898365 13:94169787-94169809 CAGAGAGAACACGTGGCTGCAGG + Intronic
1111918545 13:94386816-94386838 TAGATAGGACAAAAGGCTGCAGG - Intronic
1111928252 13:94485702-94485724 CAGAGAAAACAAAATGGGACAGG + Intergenic
1113042020 13:106114551-106114573 CAAAGAGAACAAAAGACGAAGGG + Intergenic
1114957069 14:27835761-27835783 CAGAAAGAAAAAAAGGCGGGGGG - Intergenic
1117249413 14:53921444-53921466 TAGGGAGAACAAAAGGGGACAGG - Intergenic
1118728815 14:68652278-68652300 CAGCAAGAGCAAGAGGCGGCTGG - Intronic
1119034209 14:71216011-71216033 AAAAGAGAACAAAAGGGGCCGGG + Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121104028 14:91269350-91269372 CAGTGGGACCAAAAGCCGGCTGG + Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1124906894 15:33877516-33877538 GTGAGAAAACAAAAGGGGGCCGG + Intronic
1125145243 15:36459930-36459952 AAAAGAAAACAAAAGGAGGCTGG + Intergenic
1126061161 15:44784270-44784292 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127981535 15:64038616-64038638 CAAAGAGAATGAAAGGCAGCAGG - Intronic
1129114819 15:73359437-73359459 CAGAGAGGACCAGAGGCAGCTGG + Intronic
1129522656 15:76195659-76195681 CAGAAAGAACAACACGGGGCAGG - Intronic
1131159452 15:90095254-90095276 CCTAGAGAACAAAAGGTGGCTGG + Intronic
1132609694 16:809307-809329 CAGATAGAACAAAAAGGGGCTGG - Intronic
1133610565 16:7429430-7429452 CAGAGAGAATAAAAGTTGGCTGG - Intronic
1133740380 16:8646830-8646852 CAGAGAGACCAAGGGGCGGAGGG - Exonic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1135031686 16:19043866-19043888 CAAAGAAAACAAAAGCAGGCCGG - Intronic
1139734157 16:68973002-68973024 GAGAGAGAACAAAGGAAGGCGGG + Intronic
1140066296 16:71614318-71614340 CAGAGAGACCCAAAGGCTGGGGG + Intergenic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1142083298 16:88162671-88162693 CACAGAGAATAAAAGGGGGGGGG - Intergenic
1142364124 16:89640816-89640838 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
1142656418 17:1397563-1397585 CAGAGAGATAAAAGGGCAGCTGG + Intronic
1142757911 17:2026209-2026231 CGGAGAGAAGAAAAAGCGGATGG + Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143865357 17:9919148-9919170 AAGGGTGAACAACAGGCGGCAGG - Intronic
1144264991 17:13560366-13560388 CACAGAGAAGCAAAGGTGGCAGG - Intronic
1144572556 17:16408535-16408557 CAAAGAGAAGCAAAGGCTGCAGG + Intergenic
1144661184 17:17071997-17072019 CAGACAGCCCAAAAGGCAGCAGG - Intronic
1145824360 17:27865959-27865981 CAGAAAGAACAAAAGGGGCCAGG + Intronic
1147530346 17:41270634-41270656 CAGAGAGAACCAAAGCAGGTGGG - Intergenic
1148770868 17:50065118-50065140 GAGAGAGAAAAAAATGCGGGGGG - Intronic
1152639657 17:81444301-81444323 CAGAGACAACAAAGGGCCGGGGG + Intronic
1153268338 18:3294477-3294499 GAGAGAGAATAAAAGGTGGAGGG + Intergenic
1153503973 18:5776411-5776433 CAGAAAGAAGAAAAGCCAGCTGG + Intergenic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1158571787 18:58602551-58602573 CACAGAGAAAAAATGGCGGTGGG - Intronic
1159442417 18:68498454-68498476 CAGAGAGAGCATAAGACAGCTGG - Intergenic
1159682890 18:71377076-71377098 CAGAGAGAAGAAAAGACAGGTGG - Intergenic
1159709892 18:71744650-71744672 CACAGAGACTTAAAGGCGGCAGG - Intronic
1160233687 18:77068460-77068482 CACAGAGAACAAAATGCAGGCGG - Intronic
1160506651 18:79430952-79430974 CAGGCAGAAGGAAAGGCGGCTGG - Intronic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1162224236 19:9206266-9206288 CAAAGAGAAGAAAAGACAGCTGG - Intergenic
1162515016 19:11142615-11142637 GAGGGAGAACAAACGGGGGCGGG + Intronic
1162553141 19:11369543-11369565 GAGACAGAAGAAAAGGAGGCTGG + Intergenic
1163075604 19:14888461-14888483 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
1163198471 19:15743415-15743437 AAGAGAGAAAAAAAGGAGGTTGG + Intergenic
1164393587 19:27845657-27845679 CAGAGAGAAGGAAAGTTGGCAGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1166023839 19:40060199-40060221 AACAGAGAACAAAAGGCAGTGGG + Intergenic
1167108263 19:47443689-47443711 CAGAGACACCAAGAGGCGTCAGG - Intronic
1168039371 19:53745889-53745911 GAGAGAGAAGAAAAGGCAGCTGG + Intergenic
1168416018 19:56169198-56169220 CAGAAAAAACAAAAGCCAGCTGG + Intergenic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
925004195 2:428609-428631 GAGAGAGAAGAAAAGGGGCCCGG - Intergenic
925178022 2:1798451-1798473 CAGAGAGAACATCAGGCCGTGGG + Intronic
925533659 2:4892657-4892679 CACAGAAAACAAAAACCGGCTGG + Intergenic
925952808 2:8930949-8930971 CCGAGAGAAAAAAAAGCTGCAGG - Intronic
927061509 2:19427161-19427183 CAGAGAGAAGAAAAGGAGGTAGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927486104 2:23489392-23489414 CAGATAGAAGAAAAGCCTGCAGG - Intronic
928208043 2:29301331-29301353 GAGAGAGAAGACAAGGCAGCAGG - Intronic
930616297 2:53598224-53598246 CAGACAGTACAAAAGGAGGAAGG + Intronic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931195969 2:60052632-60052654 CAGATAGAACAATAGGGTGCAGG - Intergenic
932336075 2:70932128-70932150 CAGAGAGAACAAAGGGAGAGAGG + Intronic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
934107220 2:88706500-88706522 CAGTGAGAACACATGGAGGCAGG + Intronic
934130118 2:88939727-88939749 CAGAGAGAGCACAAAGCTGCGGG + Intergenic
934134853 2:88985520-88985542 CAGAGAGAGCACAAAGCTGCCGG + Intergenic
934510950 2:94942644-94942666 CAGAGAGAAAAAAAAGAGGAAGG + Intergenic
935389540 2:102535958-102535980 CAAAGAGAACAAAATCTGGCTGG - Intergenic
936144476 2:109970608-109970630 CAAAGAGAAGAAAAGACAGCTGG - Intergenic
936155771 2:110046666-110046688 CAGAGAGCACAAAATGCAGCTGG + Intergenic
936188917 2:110324762-110324784 CAGAGAGCACAAAATGCAGCTGG - Intergenic
936200211 2:110400861-110400883 CAAAGAGAAGAAAAGACAGCTGG + Intergenic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
938638970 2:133259911-133259933 CACTGAGAAAAAAAGGCAGCTGG + Intronic
939445511 2:142304795-142304817 AAGAGAGAACACATGGTGGCAGG - Intergenic
939858100 2:147385121-147385143 CAAAGAGAACAAAAAGGCGCAGG + Intergenic
939938203 2:148317613-148317635 TAGAGACAACAAAAGGTGGGAGG - Intronic
941013370 2:160326563-160326585 CAGAGAGAACAGAATGAGACTGG + Intronic
941224827 2:162835361-162835383 TAGAGAGAAAAAAAGACAGCAGG - Intronic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
941731486 2:168922679-168922701 GACATAGAACTAAAGGCGGCAGG - Intergenic
942044028 2:172088639-172088661 CAGACAGAGCAAAAGGAGACAGG - Exonic
943084495 2:183295782-183295804 CAAAGAGAAAAAAAGACAGCTGG - Intergenic
944536316 2:200713803-200713825 CAGAGAGGACCAAAGGAGGAAGG - Intergenic
946576786 2:221084267-221084289 CAGAGAGAGCAAAGAGCTGCTGG + Intergenic
947302791 2:228706822-228706844 CAGAGAGTACAAAAGATGACTGG - Intergenic
947511952 2:230763823-230763845 CAGAAAGTACAAATGGTGGCTGG + Intronic
948410868 2:237759499-237759521 GAGAGAGAGCCACAGGCGGCAGG + Intronic
948926361 2:241101325-241101347 CAGTGAGAATCTAAGGCGGCTGG + Intronic
1169039383 20:2480495-2480517 GACAGAGAGCAAAAGGGGGCTGG - Intronic
1169157054 20:3340611-3340633 CAAAGAGAACAAATGGCTGCCGG + Exonic
1170640769 20:18150689-18150711 CAGAGCGAACAAAGGACGGACGG - Intronic
1171035556 20:21709961-21709983 TAGAGAGAAAAAAAGGCGTTTGG + Intronic
1171303420 20:24084139-24084161 CAGACAGAACAATATGCTGCAGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172232714 20:33347904-33347926 CAGCGAGGACCAAAGGAGGCAGG + Intergenic
1173051051 20:39562208-39562230 CAAAGAGAATAAAAGGGGTCAGG + Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174891710 20:54402362-54402384 CAGAGAGAAGAAAATGATGCTGG - Intergenic
1174990705 20:55506258-55506280 GAGAGTGAACCAAAGCCGGCTGG + Intergenic
1177052428 21:16253833-16253855 GAGAGAGAGAAAAAGACGGCAGG + Intergenic
1177544127 21:22534634-22534656 CAGAGAGAAAAAAAGGCTGAAGG - Intergenic
1179487715 21:41721648-41721670 AAGGGAAAGCAAAAGGCGGCAGG - Intergenic
1179599313 21:42465536-42465558 CAGAAAGAAAGAAAGGCGGAGGG - Intergenic
1180186778 21:46144258-46144280 CAAAGAGAAGAAAAGACAGCTGG - Intronic
1181174331 22:21027318-21027340 GAGAGAGAGCAGAGGGCGGCAGG + Exonic
1181778084 22:25174293-25174315 CAGAGAAGACAAACGGCTGCTGG - Exonic
1181894426 22:26094328-26094350 CAGAGAGACCAAAAACCGACTGG - Intergenic
1182494162 22:30694737-30694759 CCGAGAGCACAACAGCCGGCGGG + Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
949121263 3:387366-387388 AAGAAAGAACAAAAGGAGCCAGG - Intronic
949437265 3:4043026-4043048 TAGAAAGACCAAAAGGTGGCAGG + Intronic
949882949 3:8675872-8675894 CAGAGAGAAAAGATGGCAGCTGG + Intronic
950471117 3:13186988-13187010 AAGAAGGAAGAAAAGGCGGCAGG - Intergenic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
952596546 3:35025704-35025726 CAGATAGAACAAAAGGTGAAGGG - Intergenic
952947618 3:38489922-38489944 CAGAGAGGACAAAATGTGCCTGG - Exonic
953374041 3:42413635-42413657 CAGAGAGAACCAAAGAGGGGCGG - Intergenic
953515117 3:43583133-43583155 CAGAGAGAATATAAAGCTGCAGG + Intronic
956164815 3:66388672-66388694 CACAGAGAACAGAAGGCAGTAGG + Intronic
956165226 3:66393244-66393266 CAGTGAGCACAAAAGGCAGGAGG + Intronic
956202891 3:66725658-66725680 AAGAGAGAAAAAAAGCAGGCTGG + Intergenic
956203045 3:66727689-66727711 AAGAGAGAAAAAAAGCAGGCTGG - Intergenic
956856490 3:73280212-73280234 AAGAGAGAACAAGGGCCGGCAGG + Intergenic
956895952 3:73659962-73659984 CAGAGACAATAAATGGTGGCAGG - Intergenic
957381764 3:79440012-79440034 CAGATAGAACAAAAGGTAGAGGG + Intronic
958001370 3:87753594-87753616 CAAAGAGAAAAACAGACGGCTGG + Intergenic
963231492 3:142912537-142912559 CAGAGAGAAGAAAGGGAGTCAGG + Intergenic
965145566 3:164897575-164897597 CTGAGAGGACAAAAGGTGACAGG + Intergenic
969296478 4:6273132-6273154 CAGAGAGAACAGAATGGGGGTGG + Intronic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
970231453 4:13915455-13915477 CAGAGAGGACAAAAGGGAGGTGG - Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
972357073 4:38289785-38289807 CAGGGAGAAGAAAAGGAGCCTGG + Intergenic
972516985 4:39818252-39818274 TAGAGAGAAGAAAATGAGGCCGG + Intergenic
974080584 4:57208354-57208376 CAGAGAGAATCAGAGGAGGCTGG + Intergenic
974508545 4:62807725-62807747 CAATGGGAACAAAAGGGGGCTGG + Intergenic
975013386 4:69381539-69381561 CTGAGAGAAAAAAAAGCTGCAGG - Intronic
975025761 4:69546590-69546612 CAGAGACAAAAAAAAGAGGCTGG - Intergenic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
976249040 4:83032158-83032180 GAGAGAGAACACAAAGCGGGAGG - Intergenic
982244091 4:153332346-153332368 AATAATGAACAAAAGGCGGCTGG + Intronic
982532834 4:156568712-156568734 AAGAGAAGACAAAAGCCGGCTGG - Intergenic
983567187 4:169165621-169165643 CTCAGAGAAAAAAAGGCGGGGGG + Intronic
984378619 4:178963020-178963042 CAGAGTGGACAAGAAGCGGCAGG + Intergenic
985921211 5:2977289-2977311 CAAAGAGAACAAAAGGAGACTGG - Intergenic
986103501 5:4636715-4636737 CAGTGAGCACAAAAGAGGGCAGG - Intergenic
991244673 5:64497638-64497660 CAGAGAGGAAAAAAGGCAGAGGG - Intergenic
992551692 5:77865872-77865894 CAGAGTGGACAAACGGAGGCTGG - Intronic
993263214 5:85688446-85688468 CAGAGAGAGTAAAATGGGGCTGG - Intergenic
993588386 5:89761273-89761295 CAGAGAGAACAAAAATCTGAAGG - Intergenic
998985920 5:147756635-147756657 CTGAGAGAAGAAAAGGAGGGTGG + Intronic
1002084624 5:176765800-176765822 CAAAGAGAAAAAAAGACTGCGGG - Intergenic
1006131940 6:31874854-31874876 CAGAGAGAACACTAAGGGGCTGG + Intronic
1006826633 6:36940634-36940656 GAGGGAGAAGAAAAGGAGGCGGG + Intergenic
1008338580 6:50336702-50336724 TAGAAAGAACAAATAGCGGCCGG + Intergenic
1008564294 6:52751999-52752021 CAGACAGAACATGCGGCGGCAGG - Intronic
1008568603 6:52793279-52793301 CAGACAGAACACATGGAGGCAGG - Intronic
1008573055 6:52833281-52833303 CAGACAGAACACATGGAGGCAGG - Intronic
1011176785 6:84570766-84570788 CAAATAGAACAAAAGGTGGGAGG - Intergenic
1013990957 6:116253449-116253471 CAGAAGGAAAAAAAGGTGGCAGG - Exonic
1014086561 6:117352735-117352757 CAGAGAGAACAACAGGACGCAGG + Intronic
1015259077 6:131213921-131213943 CAGAGAGAACAACAGGTCACTGG - Intronic
1015385641 6:132619962-132619984 CAGAGAGAATACAAGGTGGAGGG + Intronic
1015579423 6:134707318-134707340 TTGAGAGAACAAAAGGCGAGAGG - Intergenic
1016138412 6:140576619-140576641 CAGAGAGAAAAAAAAGGAGCTGG - Intergenic
1016834134 6:148460054-148460076 CAGACAGAACAAAAGGAGGCAGG + Intronic
1019654152 7:2179572-2179594 CAGAGGGAACAGAATGGGGCTGG + Intronic
1019994035 7:4711819-4711841 CAGAGAGAAAAGATTGCGGCCGG + Intronic
1020112591 7:5455945-5455967 CAGAGGGAACGAAATGCGGCAGG - Intronic
1021651104 7:22834259-22834281 CAGGGAGAAAAATAGGCAGCAGG - Intergenic
1023612293 7:41983260-41983282 CAGAGAAAAGAAAAGGCAGTAGG + Intronic
1023859599 7:44210203-44210225 CACAGGAAACAAAAGGCGGTGGG - Intronic
1023900076 7:44469227-44469249 CACAGAGAACAAAAAGCAGATGG - Intronic
1024113122 7:46166584-46166606 CAGAGAGAGAAAAGGGCAGCAGG + Intergenic
1024341107 7:48261314-48261336 CAGTGAGAAGGAAAAGCGGCGGG - Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1026795692 7:73364562-73364584 CCGAGAGTAGGAAAGGCGGCGGG + Intergenic
1027189066 7:75987543-75987565 CAAAGAAAAGAAAAGGCAGCAGG + Exonic
1028246664 7:88487324-88487346 GAGAGAGAAAAGAAGGCGGGGGG + Intergenic
1028492512 7:91427974-91427996 GAGAGAAAACATAAGGTGGCTGG + Intergenic
1029650045 7:101885418-101885440 GAGAGAGAACCAAAGGTGGGAGG + Intronic
1032118561 7:129138712-129138734 CAGAGAGACAGAAAGGGGGCAGG - Intergenic
1032705534 7:134418475-134418497 TAGAGACAATAAAAGGCAGCAGG - Intergenic
1032759053 7:134920928-134920950 CAGAGAAAACAAAAGGCTCAAGG - Intronic
1033127332 7:138717609-138717631 CAGAGATAACAAAACAAGGCCGG + Intronic
1033166236 7:139040887-139040909 CAGAGAGCTCAAAAGCAGGCTGG + Intergenic
1033993864 7:147321168-147321190 CAGAGAGAAGAAAAGGAGGGAGG - Intronic
1034995837 7:155576907-155576929 CAGAGAGGACTAAATGCGGAAGG + Intergenic
1035981493 8:4377274-4377296 CAGAGAGAGCAAAAGGGAGGAGG + Intronic
1036574454 8:10013236-10013258 CAGAGTGCACAAAAGCAGGCAGG - Intergenic
1036906089 8:12709555-12709577 GAGAGAGAAAAAATGGCAGCTGG - Intergenic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1039704922 8:39996571-39996593 GAGATAGAATAAAAGACGGCTGG - Intronic
1039862300 8:41469255-41469277 CAGAAAGAAGAAAAGGAGGGAGG - Intergenic
1043037884 8:75220499-75220521 AAAAGAGAAAAAAAGGAGGCAGG + Intergenic
1043390323 8:79785477-79785499 CAGAGTGTACAAAAGGCCACCGG + Intergenic
1044083994 8:87921155-87921177 CAGATAGAACAAAAAGAGGAAGG + Intergenic
1044093501 8:88031520-88031542 AAGAGAGAAAAAAAGGGGGGGGG + Intergenic
1044266230 8:90184897-90184919 AAGAGAGAACAAAAGTCTCCTGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1048147713 8:131862013-131862035 CAGAGAGAAATAAATGCTGCAGG + Intergenic
1049870903 8:144975108-144975130 AAGAGATGACAAAAGGAGGCTGG - Intergenic
1050634188 9:7592844-7592866 TAGAGAGAACAAAAGACTGCAGG + Intergenic
1050682528 9:8129776-8129798 CGGAGACTACAAAAGGGGGCAGG - Intergenic
1050862422 9:10450724-10450746 CAGAAAGAACAAAGGCCAGCAGG - Intronic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051465996 9:17378473-17378495 AAGAAAGAACAAAAGAAGGCCGG - Intronic
1051923070 9:22290656-22290678 CAGAGAGAACAAAAAGGTGAAGG - Intergenic
1053736922 9:41107981-41108003 CAGAGAGAAAAGATGGCAGCTGG + Intergenic
1054691450 9:68323416-68323438 CAGAGAGAAAAGATGGCAGCTGG - Intergenic
1055327086 9:75142042-75142064 AATAAAGAACAAAAGGAGGCTGG - Intronic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1056959995 9:91114756-91114778 TAGAGAGAAGAAAAGGAGGCTGG - Intergenic
1056968366 9:91182820-91182842 GAGAGAGAAGAAAAGGAGGTGGG - Intergenic
1058448147 9:105071888-105071910 AAGAGAACAAAAAAGGCGGCTGG - Intergenic
1058981358 9:110173612-110173634 GAGAGAGAGAAAAAGGCAGCTGG - Intergenic
1059552663 9:115245096-115245118 CACAGAGAAAAAAAGGAGGAAGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1061624436 9:131833448-131833470 CTGAGGGAACAAAAAGAGGCTGG - Intergenic
1062430558 9:136525238-136525260 CAGAGAGAACAAGGGGAGCCAGG + Intronic
1188212463 X:27441979-27442001 CAGAGAAAAGAAAAGACAGCTGG + Intergenic
1189330728 X:40143275-40143297 AAGAGAGAGGGAAAGGCGGCAGG - Intronic
1190288935 X:48979180-48979202 CAGAGAGAAAAAAAGATGCCGGG + Intronic
1190942683 X:55057490-55057512 CAGTGAGAATGGAAGGCGGCAGG - Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192718821 X:73670204-73670226 CACAGAGAACAAAAGCAGGGTGG - Intronic
1193850830 X:86535704-86535726 CAGAGAGAAAAAAAAACGGTAGG + Intronic
1194810489 X:98381967-98381989 CAGATAGAACAACAGGCAGAGGG - Intergenic
1195052024 X:101105734-101105756 CTGAGATATCAAAAGGAGGCTGG - Intronic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199547272 X:149019343-149019365 CAGAGAGAAGAAATGGAGACTGG + Intergenic