ID: 975241955

View in Genome Browser
Species Human (GRCh38)
Location 4:72070407-72070429
Sequence TTTTAAAGGAAAAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975241950_975241955 14 Left 975241950 4:72070370-72070392 CCATAAGCAAATTCAGGGAGGTA 0: 1
1: 0
2: 1
3: 20
4: 181
Right 975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG No data
975241946_975241955 27 Left 975241946 4:72070357-72070379 CCAATAGGAATAACCATAAGCAA 0: 1
1: 0
2: 1
3: 12
4: 200
Right 975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975241955 Original CRISPR TTTTAAAGGAAAAATGAGGA GGG Intronic
No off target data available for this crispr