ID: 975243887

View in Genome Browser
Species Human (GRCh38)
Location 4:72095235-72095257
Sequence GTCTGCTGGTGTGCTGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975243882_975243887 30 Left 975243882 4:72095182-72095204 CCAATCCTCAGAAATAAACACTG 0: 1
1: 0
2: 4
3: 40
4: 350
Right 975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG 0: 1
1: 0
2: 2
3: 9
4: 162
975243883_975243887 25 Left 975243883 4:72095187-72095209 CCTCAGAAATAAACACTGTTAAC 0: 1
1: 5
2: 16
3: 81
4: 542
Right 975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG 0: 1
1: 0
2: 2
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975243887 Original CRISPR GTCTGCTGGTGTGCTGGAAC TGG Intronic
900137308 1:1123189-1123211 ATCTGCGGGTTTGCTGGTACTGG - Intergenic
900187897 1:1341158-1341180 GTGTGCAGGTGTGCTTGTACAGG - Intronic
900604918 1:3519663-3519685 GCCGCCTGGTGTGCTGGAGCCGG - Intronic
900693601 1:3996410-3996432 GTCTGCGGTGGAGCTGGAACTGG + Intergenic
900942018 1:5805143-5805165 GTCTGCTGCTATGCTGGGAGTGG - Intergenic
901212706 1:7535375-7535397 GCCTGCTGGTGTGCAGGGGCAGG + Intronic
901588219 1:10316278-10316300 GTCTACTGATGTGATGCAACAGG - Intronic
901716342 1:11157689-11157711 ATCTGCTGGAGTGCTGACACTGG + Intronic
901773067 1:11540667-11540689 GTCAGCTGGTGGGGTGGACCTGG - Intergenic
902584081 1:17427357-17427379 GTCTGCAGGTGTGCTGCTTCAGG - Intronic
902706753 1:18210718-18210740 GGCATCTGGTGTGCAGGAACCGG - Intronic
903010641 1:20327794-20327816 GGCTGCTCGTGTGCTGGGAAAGG + Intronic
904392689 1:30196313-30196335 TTCTGCAGGTGTGCTGGGGCTGG - Intergenic
905183440 1:36179920-36179942 TTCTCCTGGTGTGCTGGGAGAGG - Exonic
905225489 1:36476031-36476053 ATCTGGTGGTGTGCTGGTGCTGG - Intronic
909516681 1:76516172-76516194 GCCAGCTGTTGTGCTGGAAATGG + Intronic
909803683 1:79847800-79847822 GTCTGCTGCTACCCTGGAACAGG + Intergenic
912860975 1:113213625-113213647 GTCGTCTGGTGAGCTGGTACAGG - Intergenic
919370843 1:196724029-196724051 GTCTGCGTGTCTGCTGGAAGTGG + Intronic
920266724 1:204729651-204729673 GGCTGCTGCTGACCTGGAACTGG + Intergenic
921255001 1:213331123-213331145 GACTGCTAATGTGCTGGCACAGG + Intergenic
924628623 1:245716242-245716264 GTCAGCTGTGGTGCTGGAAGTGG + Intergenic
924892947 1:248304870-248304892 ATTTGCTGGTGTGGTGGCACAGG + Intergenic
1063066469 10:2615011-2615033 GTCTACTGGGGTGCTGGTGCTGG + Intergenic
1063904788 10:10770408-10770430 GTCTGCTGGGGTGGAGGCACTGG + Intergenic
1066216410 10:33292658-33292680 ATCTGCTTATCTGCTGGAACTGG - Intronic
1066379483 10:34889118-34889140 CCCTGATGGTGTGCTGGAAATGG - Intergenic
1070378540 10:75858150-75858172 CACTGCTGGTGGGCTGGTACGGG - Intronic
1075020208 10:118946564-118946586 GACCACTGGTGTGCTGGAGCGGG + Intergenic
1076021063 10:127073894-127073916 GTCTGCTGAGGTGATGGAAAGGG + Intronic
1078955851 11:16194138-16194160 AGCTGCTGGTATGCTGGGACAGG - Intronic
1079960053 11:26912949-26912971 GTACACTGGTGTGCTGTAACTGG - Intergenic
1081685160 11:45037180-45037202 GTCTGCTGGTCTGTTGGGAGAGG - Intergenic
1083194823 11:61079566-61079588 GTCTGCGGCTGTGCTGGGCCTGG - Intergenic
1084872532 11:72107957-72107979 CCCTGCTTGTGTGCTGGAATTGG + Exonic
1084922058 11:72479251-72479273 GTCTGCTGATGTCCTGGAATAGG + Intergenic
1085512241 11:77094287-77094309 AGCTGCTGGTGTTCTGGACCAGG + Intronic
1085512264 11:77094381-77094403 AGCTGCTGGTGTTCTGGACCAGG + Intronic
1091075055 11:132607507-132607529 GTATCCTTGTGTTCTGGAACTGG + Intronic
1092431701 12:8414979-8415001 GTTTGCTGATTTGATGGAACAGG - Intergenic
1092434652 12:8437602-8437624 GTTTGCTGATTTGATGGAACAGG - Intergenic
1093308076 12:17544163-17544185 GTATGCTGGTGAGGTGGATCGGG + Intergenic
1095568452 12:43654128-43654150 ATCCACTGGTGTGCTGGACCTGG + Intergenic
1096386368 12:51197640-51197662 CTCTGCTGATGTGTTGGAAAAGG + Intronic
1096646186 12:53037745-53037767 GTCTCTTAGTGTGCTGGAACTGG + Intronic
1098291301 12:68959029-68959051 GACAGCTGGGGTGCAGGAACTGG - Intronic
1102679802 12:114683726-114683748 GTCTGCAGCTGTGCTAGACCCGG + Intronic
1104365081 12:128169496-128169518 GTCTTCTGGGCTGCTGGAAAGGG + Intergenic
1106175598 13:27328310-27328332 GCCTGCTGGTGTGAGGAAACAGG - Intergenic
1110313295 13:74075836-74075858 TTCTGCTGGTGTGCTGGGCTGGG - Intronic
1114494988 14:23126303-23126325 GTGTGCGGGTGTGCTGGGAGTGG + Exonic
1116707032 14:48315566-48315588 GTCTCCTGGTGTGCCGGTAAAGG + Intergenic
1117039619 14:51757764-51757786 GTTTGCTGATTTGATGGAACAGG + Intergenic
1125728531 15:41880394-41880416 CTCTGCTGGTGGGCTGGGATGGG - Intronic
1125873415 15:43123055-43123077 CGATGCTGGTGAGCTGGAACTGG - Intronic
1126990273 15:54366893-54366915 GTATCCTGCTGTGCTGTAACAGG - Intronic
1127936119 15:63640321-63640343 TTCTGGTGGTGTGGTGGCACTGG + Exonic
1128008971 15:64272749-64272771 GTCTGGTGGTGTTTTGGAATGGG + Intronic
1128392399 15:67191047-67191069 GTCTGCTGGAGTGGTGGGGCGGG - Exonic
1131789649 15:95950115-95950137 TTTTGCTGGTGTGCTGAACCTGG + Intergenic
1132116170 15:99138013-99138035 GTCTGCTGTTGTGCCGGGCCGGG + Exonic
1133588766 16:7221960-7221982 GTCTGCTTCTGTGATAGAACAGG + Intronic
1136983690 16:35081563-35081585 TTCAGCTGGTGTGCTGGACGTGG + Intergenic
1141696363 16:85621676-85621698 GTCTGCTTGGATGCTGGAGCTGG + Intronic
1143377445 17:6475156-6475178 GTCTGCGGGTTGCCTGGAACAGG - Intronic
1143599746 17:7936711-7936733 GTGTGGTGGAGGGCTGGAACCGG + Exonic
1144385095 17:14741849-14741871 GTCTGCTGATGTGGTGACACTGG + Intergenic
1146083535 17:29805494-29805516 GTCCGCTGGTGTGCTGGAGCTGG + Intronic
1147366429 17:39962586-39962608 GTCTGCGGGTGTCCTGGGATAGG - Intergenic
1148619175 17:49021843-49021865 GTCTACTGAAGTGCTGGAGCGGG + Intronic
1148702090 17:49594271-49594293 GTCCAGTGGTGTGCTGGAGCTGG + Intergenic
1149722882 17:58863717-58863739 GTGTGCTGGGGTGCTGGAAAGGG + Intronic
1151939330 17:77282761-77282783 GTGTGCTGGTGGGCGGGAGCGGG + Intronic
1152158389 17:78650225-78650247 GGCTGCTGGTCAGCTGGAAACGG + Intergenic
1152720506 17:81921296-81921318 TTCTGCTGGCTTGCTGGACCTGG - Exonic
1155126159 18:22878209-22878231 GTCTCCTGGTGTGATGTAATAGG + Intronic
1155416386 18:25604390-25604412 GTCTTCTGGGGCTCTGGAACAGG - Intergenic
1155855108 18:30824245-30824267 ATCTACTGGTTAGCTGGAACTGG - Intergenic
1160154351 18:76422224-76422246 GTCTCCTGGTTTGCTGGGTCAGG - Intronic
1160367314 18:78337508-78337530 GGATGCAGGTGCGCTGGAACTGG - Intergenic
1160741024 19:685887-685909 GGCCCCTGGTGTGCAGGAACCGG - Exonic
1160941664 19:1622937-1622959 GTCTGCTGCTGTGCTGGAGCGGG + Intronic
1161008338 19:1947695-1947717 GCCTGCAGGTGGGCTGGGACAGG + Intronic
1163321078 19:16575289-16575311 GTCTGGTGGTCTGATGGAAGAGG + Exonic
1167037299 19:47001937-47001959 GTCTGCTGGTGCCCTCGAAGGGG + Exonic
926109580 2:10173463-10173485 GTTTGCGGGGGTGCTGGAACTGG - Intronic
928175782 2:29033524-29033546 GTCTGGTGGTGTGTGAGAACGGG + Exonic
931300851 2:60976655-60976677 ATCTGCTGGCATGCTGGAGCAGG - Intronic
933695283 2:85212999-85213021 GTCTGGTGGAGTCCTGGAAGTGG + Intronic
934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG + Intergenic
935112879 2:100108101-100108123 GTCTGCAGCTTTGCTGGAACAGG - Intronic
939897187 2:147806427-147806449 GTCTGCTACATTGCTGGAACAGG - Intergenic
940870298 2:158854352-158854374 GTTTGCTGATTTGATGGAACAGG + Intronic
940873005 2:158875446-158875468 GTTTGCTGATTTGATGGAACAGG + Intergenic
945995484 2:216432588-216432610 GTCTGGTGGTGGGCTGGGCCCGG + Intronic
947620983 2:231590899-231590921 ACCTGCTGGTGTGGTGGAACCGG + Intergenic
948714675 2:239853326-239853348 GTGTGCTGGTGGACTGGAGCGGG - Intergenic
1172763164 20:37336293-37336315 GTCAGCTCCTGTGCTGGAGCTGG - Intergenic
1174408159 20:50316357-50316379 GTGTGCTGGAGTGGAGGAACAGG - Intergenic
1174663406 20:52235340-52235362 ATCTGCTGGTCTCCTGGAATTGG + Intergenic
1174870040 20:54173694-54173716 GCCAGCTGGTGTGATGGAGCGGG + Exonic
1176307493 21:5131566-5131588 GGCTGCTGGGGTGGAGGAACCGG - Intronic
1178952001 21:36992866-36992888 GGCTGCTGGTCTGCAGGAAGGGG - Intergenic
1179442909 21:41407981-41408003 GTTTGCTGGTTTCCTGGAAGAGG - Exonic
1179842670 21:44087393-44087415 ATCTGCGGATGAGCTGGAACGGG + Intronic
1179849567 21:44130464-44130486 GGCTGCTGGGGTGGAGGAACCGG + Intronic
1181175340 22:21031981-21032003 GCCTGCTGGAGAGCTGGAATGGG + Intronic
1182770417 22:32791653-32791675 GTATGCTGCCGTGCTGGAATTGG - Intronic
1184757802 22:46526691-46526713 GTCTGCTTGGGAGCTGGAGCAGG - Intronic
951786179 3:26421709-26421731 GTCTGCTGTTGAGATGGAGCTGG + Intergenic
954043629 3:47910149-47910171 CTCTGATGGTGTTCTGGGACAGG + Intronic
954873034 3:53782400-53782422 GAATGCTGGTGTGGTGGCACTGG - Intronic
957075395 3:75598850-75598872 GTTTGCTGATTTGATGGAACAGG - Intergenic
960179216 3:114555011-114555033 GTTTTCTGGTATGCTGGAGCTGG - Intronic
963333706 3:143946958-143946980 GAGTGGTGGTGTTCTGGAACTGG - Intergenic
965612324 3:170557438-170557460 GTCAGGTGCTGTGCTGGAGCAGG + Intronic
966079987 3:175989181-175989203 GTCTGATGGTGCACTGGGACAGG + Intergenic
966821931 3:183931655-183931677 TTCAGCTGGTGTGATGGACCTGG - Intronic
968218383 3:196914211-196914233 ATCTGCTTCTGTGCTGTAACAGG - Intronic
969023680 4:4156678-4156700 GTTTGCTGATTTGATGGAACAGG - Intergenic
969734999 4:8982192-8982214 GTTTGCTGATTTGATGGAACAGG + Intergenic
969794218 4:9513672-9513694 GTTTGCTGATTTGATGGAACAGG + Intergenic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
977230962 4:94451409-94451431 GTCTTCTGGTGTGATGGACAGGG + Intergenic
981576443 4:146211016-146211038 GTCTGCTGGAGTGAAGGAGCAGG + Intergenic
984966549 4:185144760-185144782 GTTTGCTGGCATGCTGGACCTGG - Exonic
987153422 5:15063357-15063379 GTTTGCTGGGGTGCTTGACCTGG + Intergenic
993271562 5:85803640-85803662 GTCCGCTGCTGTGCTGGTTCAGG + Intergenic
994865221 5:105260022-105260044 GTCTACTGCTGTGCTTGTACTGG + Intergenic
997116612 5:131132137-131132159 ATCCACTGGTGTGCTGGAGCTGG + Intergenic
998128163 5:139637941-139637963 GCCGGCCGGTGTGCTGGGACTGG + Intergenic
998489966 5:142538113-142538135 GTCTTCTGATGTGATGCAACAGG + Intergenic
999358116 5:150956577-150956599 CTCTGCTGGAGTGCTGTCACAGG - Intergenic
1000021027 5:157319708-157319730 GACAGCTGGTGTGCTGGACATGG + Intronic
1002829230 6:804247-804269 GTCTGCTGGTGAGATGGCTCAGG + Intergenic
1006105614 6:31714451-31714473 GCCTGCTGATGTGCTTGCACTGG + Intronic
1007171371 6:39865651-39865673 GCCCCGTGGTGTGCTGGAACTGG + Intronic
1009039238 6:58157693-58157715 GTGTGCTGAGCTGCTGGAACTGG + Intergenic
1009215137 6:60912536-60912558 GTGTGCTGAGCTGCTGGAACTGG + Intergenic
1010450210 6:75994010-75994032 GTGTGCTGGTTTTCTGGCACTGG + Intronic
1010455940 6:76054789-76054811 GTCCACTGGTTTGCTGGAACTGG - Intronic
1013461557 6:110379103-110379125 GTCTGCTGGTCTGCAGAGACTGG - Intergenic
1013854384 6:114554077-114554099 GTTTGCTGTTATGGTGGAACTGG + Intergenic
1018263145 6:161990100-161990122 GTCTGCTTATGTGCTGGCAGTGG - Intronic
1020310787 7:6866854-6866876 GTTTGCTGATTTGATGGAACAGG - Intergenic
1021799047 7:24285462-24285484 ATCTCCTGGTGTGCAGGCACTGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1024936347 7:54715854-54715876 CTCTGCTGAAGTGCTGCAACTGG - Intergenic
1035241608 7:157534234-157534256 GTCAGCTGGGGTGCGGGAAGAGG - Intergenic
1035295104 7:157862797-157862819 GCCTGGTGGTGTGCGGGAAGCGG + Intronic
1035690330 8:1555584-1555606 GTCTGCAGGAGTGCAGGAGCTGG + Intronic
1036194209 8:6699740-6699762 GCCTCCTGGTGTGCTGGGAAGGG + Intergenic
1036261756 8:7246817-7246839 GTTTGCTGGTTTTATGGAACAGG - Intergenic
1036304835 8:7592735-7592757 GTTTGCTGGTTTTATGGAACAGG + Intergenic
1036313796 8:7705362-7705384 GTTTGCTGGTTTTATGGAACAGG - Intergenic
1036355686 8:8040727-8040749 GTTTGCTGGTTTTATGGAACAGG + Intergenic
1040963694 8:53062662-53062684 GTCTGATGGTGTGTTGGAATTGG - Intergenic
1049680053 8:143914096-143914118 GCCTGCTGGTCCGCTGGAACAGG - Intergenic
1054826327 9:69577439-69577461 GTGTGCTGGTGTACTGGAGTGGG - Intronic
1055494395 9:76840380-76840402 GCATGCTGGTGTGCTGTAAATGG - Intronic
1056164964 9:83932222-83932244 GCCTCCTGGTGTGTTGCAACAGG - Intergenic
1056467914 9:86877158-86877180 GTCTGCGCGTGTGCTGGAGAGGG + Intergenic
1056770965 9:89478157-89478179 GCCTTCTTGTGTGCTGTAACAGG + Intronic
1059717706 9:116929155-116929177 GTGTGCAGATGTGCTGGACCTGG + Intronic
1061028422 9:128065560-128065582 GTCAGATGCTGTTCTGGAACAGG - Intronic
1062054290 9:134462981-134463003 GGCTGCTGGTGTGGTGGGATGGG + Intergenic
1185610189 X:1389709-1389731 GCTTGCTGGCGTGCTGGACCTGG + Exonic
1190916255 X:54813236-54813258 GTCTGGTGGTCTGGTGGAGCGGG + Intronic
1190928127 X:54926701-54926723 GTCTGGTGGTCTGGTGGAGCGGG + Intronic
1192538763 X:71950412-71950434 GCCTGCTGGTGCACTGGGACTGG + Intergenic
1195064853 X:101231716-101231738 GGCTGCTGCTATGATGGAACTGG - Exonic
1195765278 X:108289838-108289860 TTCCAGTGGTGTGCTGGAACTGG + Intronic
1198072106 X:133159304-133159326 GACTGCTGCTGTGCTGGCAGTGG - Intergenic
1199530197 X:148838115-148838137 GTCTGCTTGTGAGCAAGAACTGG - Intronic