ID: 975245281

View in Genome Browser
Species Human (GRCh38)
Location 4:72113403-72113425
Sequence ATGGCTAAATGGATTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 12, 3: 112, 4: 783}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975245281 Original CRISPR ATGGCTAAATGGATTGATGA AGG (reversed) Intronic
900498693 1:2989126-2989148 ATGGGTAGATGGATGGATGGAGG - Intergenic
900498744 1:2989343-2989365 ATGGATAAATGAGTGGATGATGG - Intergenic
900498766 1:2989463-2989485 ATGGATGGATGGATGGATGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900498790 1:2989569-2989591 ATGGACAAATGGATGGAAGATGG - Intergenic
900509425 1:3051531-3051553 ATGGATGGATGGATGGATGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900535685 1:3176044-3176066 ATGGTTGGATGGATGGATGAGGG - Intronic
900535719 1:3176208-3176230 ATGGCTTGGTGGATAGATGAGGG - Intronic
900535792 1:3176602-3176624 ATGGATAGATGAATGGATGATGG - Intronic
900535800 1:3176646-3176668 ATGGCTGGATGGATAGATGAGGG - Intronic
900896802 1:5488332-5488354 ATGGATGAATGGATAGTTGAAGG - Intergenic
900922004 1:5678790-5678812 ATGGATGGATGGATGGATGAGGG + Intergenic
900931020 1:5737659-5737681 ATGGATGGATGGATGGATGATGG + Intergenic
900931032 1:5737726-5737748 ATGGATAGATGGATGGATAATGG + Intergenic
901001247 1:6149838-6149860 ATGGACAAATGGACGGATGATGG + Intronic
901001267 1:6149966-6149988 ATGGGCAAATGAATGGATGATGG + Intronic
901001374 1:6150548-6150570 ATGGACAAATGGATTGATGATGG + Intronic
901006553 1:6174490-6174512 ATGGATAGATGGATGGATGGTGG + Intronic
901006623 1:6174835-6174857 ATGGATGAATGGATGAATGACGG + Intronic
901006743 1:6175406-6175428 ATAGATGAATGGATGGATGACGG + Intronic
901180810 1:7340605-7340627 ATGCATAAATGGATAGGTGACGG - Intronic
901454767 1:9356797-9356819 ATGGACAGATGGATGGATGATGG + Intronic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902412856 1:16221587-16221609 ATGGATGGATGGATGGATGATGG + Intergenic
902621821 1:17655251-17655273 GTGGATAGATGGATGGATGATGG - Intronic
902628674 1:17691821-17691843 ATGGACAGATGGATGGATGAAGG - Intronic
902721214 1:18305417-18305439 ATGGATAGATGGATGGATTATGG + Intronic
902721222 1:18305471-18305493 ATGGATGGATGGATGGATGATGG + Intronic
902721244 1:18305579-18305601 ATGGATGGATGGATGGATGATGG + Intronic
903030422 1:20460056-20460078 ATGGACAAATGAATGGATGATGG + Intergenic
903175173 1:21576236-21576258 ATGGATGGATGGATGGATGATGG + Intronic
903352470 1:22726046-22726068 ATGGACAGATGGATGGATGAAGG - Intronic
903357827 1:22758887-22758909 ATGGCTGGCTGGATGGATGATGG + Intronic
903690428 1:25169326-25169348 ATGGATGGATGGATGGATGATGG + Intergenic
904464524 1:30699979-30700001 ATGGATGGATGGATGGATGAAGG - Intergenic
904465112 1:30702955-30702977 ATGGATGGATGGATGGATGATGG + Intergenic
904465134 1:30703124-30703146 ATGGATAGATGGATAGATGATGG + Intergenic
904581269 1:31545946-31545968 ATGGATGAATGGATGGATGGAGG - Intergenic
904581357 1:31546517-31546539 ATGGATGGATGGATGGATGATGG - Intergenic
905274627 1:36809197-36809219 ATGGATGGATGGATGGATGATGG - Intronic
906180686 1:43815915-43815937 ATGGATGGATGGATGGATGATGG + Intronic
906686202 1:47765042-47765064 CTGGCTAAATGGATTGAGCTGGG - Exonic
907774266 1:57498029-57498051 ATGGATGAATGGATGGATCAAGG + Intronic
907829697 1:58053092-58053114 ATGGCTTAATCTATTCATGAGGG + Intronic
908092405 1:60700025-60700047 ATGGCTAAAGGGACAAATGAAGG + Intergenic
908339198 1:63159045-63159067 AATGTTAAATGGAATGATGAAGG + Intergenic
908391370 1:63686692-63686714 ATGGATGGATGGATGGATGAAGG - Intergenic
908722256 1:67138137-67138159 TTGGCTTAATGGATTTATTATGG - Intronic
908956111 1:69630098-69630120 ATGGATAAATGCATGGATGGAGG - Intronic
912727991 1:112076091-112076113 GTGGGTAGATGGATTGGTGAAGG + Intergenic
914467914 1:147949013-147949035 AGGGTTAAATGGATTAATGGTGG - Intronic
914965671 1:152255838-152255860 AGGGTTAAATGGATTTATGGCGG - Intergenic
915548844 1:156619904-156619926 ATGGCTTAGTGGACTGATGGGGG + Intronic
917243184 1:172971809-172971831 ATGGATAAATGGATGAATGGAGG - Intergenic
917705823 1:177633712-177633734 ATGGCTCAATGTATTAATGAAGG - Intergenic
918411613 1:184264404-184264426 ATAGCTAAAATAATTGATGAAGG + Intergenic
919123705 1:193371600-193371622 ATGGGTTAATGGATGGAAGAGGG + Intergenic
919527516 1:198672347-198672369 TTAGCTCAATGGTTTGATGATGG - Intronic
919935098 1:202245975-202245997 ATGGATGAATGGATAGATGAAGG - Intronic
919935117 1:202246034-202246056 ATGGATGAATGGATGGATGGAGG - Intronic
919935127 1:202246066-202246088 ATGGATGAATGGATAGATGAAGG - Intronic
919935247 1:202246397-202246419 ATGGATGAATGGATAGATGAAGG - Intronic
920624387 1:207582337-207582359 ATGACTAAATGGATGATTGAGGG - Intronic
921489531 1:215757763-215757785 ATGACTAAATGGCTCAATGAAGG + Intronic
921640105 1:217543064-217543086 AAGGCTAAGTGGACTGATGTAGG - Intronic
921933512 1:220775082-220775104 ATGCCTACATGGATCTATGAAGG + Intronic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923840761 1:237669129-237669151 AGGGTTAAATGGATTAAGGACGG - Intronic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063510158 10:6636909-6636931 ATGGATAGATGGACAGATGATGG - Intergenic
1063828551 10:9926014-9926036 ATGGCTAAATGCTGTGATCATGG - Intergenic
1063957948 10:11283438-11283460 ATGGTTGGATGGATGGATGATGG + Intronic
1063957968 10:11283544-11283566 ATGGATAGATGGGTGGATGATGG + Intronic
1065941726 10:30570855-30570877 ATGTTGAAATGGAGTGATGAGGG + Intergenic
1066229319 10:33416838-33416860 GTGGCTAGTTGGATGGATGATGG + Intergenic
1066299448 10:34083986-34084008 ATGACTGATTGGAGTGATGAAGG + Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067142019 10:43666286-43666308 CTGGATTAATGGATTGATGAAGG - Intergenic
1067331880 10:45330333-45330355 ATGGTTAAATGGATTAAGGGTGG - Intergenic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1067833704 10:49624952-49624974 ATGGATATATGGATGGATGATGG + Intronic
1068302706 10:55164985-55165007 ATGCACAAATGGATAGATGACGG - Intronic
1068796038 10:61081457-61081479 AGGGCAATATGGATTAATGAGGG - Intergenic
1068810275 10:61247882-61247904 ATGGATAGATGGATGGATGGAGG - Intergenic
1069292390 10:66796392-66796414 ATGGGTAAATTAATTGATAAGGG - Intronic
1069601630 10:69711869-69711891 ATGGATGGATGGATGGATGATGG - Intergenic
1069850646 10:71402184-71402206 ATAGCTCAATGTATTGGTGAGGG + Intronic
1070749902 10:78957851-78957873 ATGGATGGATGGATGGATGAAGG + Intergenic
1071508580 10:86247369-86247391 ATGGATGGATGGATGGATGATGG + Intronic
1072542508 10:96409174-96409196 ATGGATATGTGGATGGATGAGGG - Intronic
1073450853 10:103607893-103607915 AGGGTTAAATGGATTGAGGTCGG + Intronic
1073467166 10:103700945-103700967 ATGGATGGATGGATGGATGATGG - Intronic
1073467191 10:103701059-103701081 ATGGATGGATGGATGGATGATGG - Intronic
1073467233 10:103701269-103701291 ATGGATGAATGGATAGATGATGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467250 10:103701357-103701379 ATGGATGAATGGATAGATGATGG - Intronic
1073467265 10:103701432-103701454 ATGGATGAATGGATAGATGGTGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073467290 10:103701556-103701578 ATGGATGAATGGATAGATGATGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1073608976 10:104924589-104924611 AAGGCCAAATGGCTTGATAAAGG + Intronic
1074304446 10:112263764-112263786 TTTGCTCTATGGATTGATGAAGG + Intergenic
1075648258 10:124110487-124110509 ATGGATGGATGGATGGATGATGG + Intergenic
1076117809 10:127912819-127912841 ATGGAGAGATGGATGGATGAAGG + Intronic
1076136725 10:128050242-128050264 ATGGATGGATGGATGGATGATGG + Intronic
1076494436 10:130887636-130887658 ATGGATGGATGGATGGATGAAGG + Intergenic
1076602836 10:131670116-131670138 ATGGATGAATGGATGAATGATGG + Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1076676789 10:132151296-132151318 ATGGATAGATGGATGGATGGAGG - Intronic
1076844998 10:133065631-133065653 ATGGGTGGATGGATTGATGATGG + Intergenic
1076867360 10:133174648-133174670 ATGGGTGAATGGACAGATGATGG + Intronic
1077159600 11:1106621-1106643 ATGGATAAATGGGTGGATGGTGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077354153 11:2107176-2107198 ATGGATAAATGGATACATGTAGG + Intergenic
1077480881 11:2814000-2814022 ATGGATGGATGGATGGATGATGG + Intronic
1078444512 11:11394199-11394221 TTGTCTCAATGGATGGATGAAGG + Intronic
1078754917 11:14200040-14200062 GTTGCTAAATGGGTGGATGAGGG - Intronic
1079198022 11:18347655-18347677 ATGGTTAAATCTCTTGATGATGG - Exonic
1079386182 11:19981814-19981836 GTGGCTGGATGGATGGATGATGG + Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1080781489 11:35433828-35433850 ATGGATGGATGGATGGATGAGGG + Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1080849365 11:36054928-36054950 ATGGATGGATGGATTGATGATGG + Intronic
1081246931 11:40778649-40778671 CTGGCTAAATAGATTGATCAAGG + Intronic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081626451 11:44658856-44658878 ATGGAGACATGGATGGATGAAGG + Intergenic
1081629960 11:44682340-44682362 ATGGGTGGATGGATGGATGATGG - Intergenic
1081629966 11:44682367-44682389 ATGGATAGATGGATAGATGATGG - Intergenic
1081629994 11:44682539-44682561 ATGACTAAATGAACAGATGATGG - Intergenic
1082781382 11:57290190-57290212 ATGGATGGATGGATGGATGAAGG + Intergenic
1083622405 11:64055699-64055721 ATGGATGGATGGATGGATGATGG + Intronic
1083634752 11:64114457-64114479 ATGGATAGATGGATGGATGGAGG + Intronic
1083879843 11:65542978-65543000 ATGGATGGATGGATGGATGAAGG + Intronic
1084445115 11:69199148-69199170 ATGGAGATATGGATGGATGATGG - Intergenic
1084497144 11:69511826-69511848 GCGGCTGAATGGATCGATGACGG + Intergenic
1084543830 11:69803775-69803797 ATGGATGGATGGATGGATGATGG + Intergenic
1084543847 11:69803888-69803910 ATGGATGGATGGATGGATGATGG + Intergenic
1084576540 11:69992238-69992260 ATGGATGGATGGATGGATGATGG + Intergenic
1084579222 11:70012347-70012369 ATGGATGGATGGATGGATGAAGG - Intergenic
1084579265 11:70012688-70012710 ATGGATGGATGGATGGATGAAGG - Intergenic
1084658813 11:70535409-70535431 ATGGATGGATGGATGGATGATGG - Intronic
1084705106 11:70811552-70811574 ATGGATGGATGGATCGATGATGG - Intronic
1084705120 11:70811622-70811644 ATGGATGAGTGGATGGATGATGG - Intronic
1084713066 11:70856150-70856172 ATGGATGAATGGATAGGTGATGG + Intronic
1084781886 11:71415141-71415163 ATGGGTGAATGGATGGATGATGG + Intergenic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1085406878 11:76268703-76268725 ATGGGTGGATGGATGGATGATGG - Intergenic
1085492428 11:76933535-76933557 AGGGTTAAATGGATTAAGGACGG - Intronic
1085877227 11:80423502-80423524 TTTGCTAAATGGTTTGATGTTGG + Intergenic
1086401979 11:86468335-86468357 ATGGATGGATGGATGGATGATGG - Intronic
1088353757 11:108920049-108920071 ATTGATTAATTGATTGATGAAGG + Intronic
1089143826 11:116309840-116309862 ATGGCTAAAGGGATGGAAAAGGG - Intergenic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1090323456 11:125864412-125864434 AGGGTTAAATGGATTGAGGGCGG + Intergenic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1090985357 11:131761456-131761478 AGGGCTAAATATAGTGATGAGGG + Intronic
1091187304 11:133658294-133658316 ATGGATGGATGGATGGATGATGG + Intergenic
1091187354 11:133658452-133658474 ATGGGTAGATGGATGAATGATGG + Intergenic
1091860423 12:3776554-3776576 ATAACTAAAGGGATGGATGATGG + Intergenic
1091993033 12:4972340-4972362 ATGGGTGAATGGATGGATGGAGG - Intergenic
1093245685 12:16733347-16733369 GGGGCTAAATGGAATCATGAAGG + Intergenic
1094049221 12:26200564-26200586 TTAGCTAAATGGTTTGATCATGG + Intronic
1095123316 12:38443970-38443992 TTGGCTAACAGGATTAATGAAGG - Intergenic
1095733873 12:45535681-45535703 ATGGATAGATGGATTGGTGGAGG - Intergenic
1096527413 12:52219417-52219439 ATGGATAGATAGATAGATGATGG - Intergenic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1097973456 12:65659851-65659873 ATGGATGCATGGATTGATAAGGG + Intergenic
1098399933 12:70064271-70064293 ATGAATAAATGGATTGATGTTGG - Intergenic
1098586811 12:72164153-72164175 ATCGATAAATGCATTGATGAGGG + Intronic
1099080279 12:78170264-78170286 CTGGCTAAATGGAAGGATGGTGG - Intronic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1100577451 12:95907076-95907098 AGGGTTAAATGGATTAAGGACGG - Intronic
1101607257 12:106257074-106257096 CTGGCTAAATGTATAGATAAAGG - Intronic
1101801027 12:108022053-108022075 ATGGCTGCATGCATGGATGATGG - Intergenic
1101851028 12:108402392-108402414 CTGTCTAAATGGAGTGATCAAGG - Intergenic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102043181 12:109813965-109813987 ATAGATGAATGGATGGATGATGG + Intronic
1102452721 12:113053812-113053834 ATGGATTGATGGATGGATGATGG + Intergenic
1102504242 12:113373827-113373849 ATGGGTAGATGGATGGATGATGG - Intronic
1102700016 12:114830914-114830936 ATGGATATTTGGATTGATGGTGG - Intergenic
1102856099 12:116295468-116295490 ATGGGTAGATGGATGGAGGATGG + Intergenic
1102856121 12:116295568-116295590 ATGGATGGATGGATAGATGATGG + Intergenic
1102889992 12:116551267-116551289 AGGGATAGATGGATGGATGATGG + Intergenic
1102895620 12:116595853-116595875 ATGGATGGATGGATGGATGAAGG + Intergenic
1103012774 12:117469997-117470019 ATGGATGGATGGATGGATGAAGG - Intronic
1103012784 12:117470068-117470090 ATGGGTGGATGGATGGATGAAGG - Intronic
1103012814 12:117470277-117470299 ATGGGTGGATGGATGGATGAAGG - Intronic
1103834325 12:123807128-123807150 ATGGATGGATGGATGGATGATGG - Intronic
1103900427 12:124300964-124300986 ATGGATAGATGGATGGATGGAGG + Intronic
1103941449 12:124503467-124503489 ATGGATGGATGGATGGATGATGG + Intronic
1104034655 12:125089940-125089962 ATGGATGAATGGGTAGATGATGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104034704 12:125090242-125090264 ATGGATGAATGGGTAGATGATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034728 12:125090395-125090417 ATGGATGAATGGGTAGATGATGG - Intronic
1104034774 12:125090720-125090742 ATGGATGGATGGATGGATGATGG - Intronic
1104567607 12:129899325-129899347 ATGGATGGATGGATGGATGATGG + Intronic
1104764034 12:131315021-131315043 ATTGCTGGATGGATGGATGAGGG - Intergenic
1104772581 12:131372834-131372856 ATGGATGGATGGATTGATGGAGG - Intergenic
1104772629 12:131373010-131373032 ATGGATGGATGGATTGATGGAGG - Intergenic
1104778404 12:131404630-131404652 ATGGATGGATGGATGGATGATGG - Intergenic
1104778423 12:131404708-131404730 ATGGATGGATGGATGGATGATGG - Intergenic
1104778450 12:131404809-131404831 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778506 12:131405026-131405048 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778535 12:131405139-131405161 ATGGGTGGATGGATGGATGATGG - Intergenic
1104778581 12:131405310-131405332 ATGGGTGGATGGATGGATGATGG - Intergenic
1104896220 12:132166305-132166327 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896271 12:132166523-132166545 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896313 12:132166671-132166693 ATGGGTGAATGGATGGATGATGG - Intergenic
1105279817 13:18956910-18956932 ATGGATGAATGGATTAATGAAGG - Intergenic
1105279828 13:18956988-18957010 ATGGGTAGATGGATGGATCATGG - Intergenic
1105604503 13:21915726-21915748 ATGGCTGGATGGATGGATGATGG - Intergenic
1106000584 13:25719479-25719501 ATGGATGGATGGATGGATGATGG + Intronic
1106941274 13:34782629-34782651 ATAGCTAAAATAATTGATGAAGG + Intergenic
1109907367 13:68862548-68862570 ATGGCTGAATGGATTCACTATGG - Intergenic
1109959837 13:69615650-69615672 AGGGTTAAATGGATTAATGGCGG - Intergenic
1111866773 13:93778679-93778701 TTAGCTAAATGGATTAAGGATGG - Intronic
1112729238 13:102341381-102341403 ATGGGTAGATGAATGGATGATGG - Intronic
1113072883 13:106438685-106438707 ATGGATGGATGGATGGATGATGG + Intergenic
1113072945 13:106439003-106439025 ATGGATATATGGATGGATGAAGG + Intergenic
1113109205 13:106803792-106803814 ATGGCTGATTTGATTAATGAAGG + Intergenic
1113156494 13:107328648-107328670 ATGGATAAAAGGATTGATTGAGG - Intronic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113762806 13:112861639-112861661 ATGGCTAAATATTCTGATGAGGG - Intronic
1113901024 13:113798166-113798188 ATGGATAGAAGGATGGATGATGG + Intronic
1113901038 13:113798236-113798258 ATGGATAGAAGGATGGATGATGG + Intronic
1113901092 13:113798543-113798565 ATGGATAGAAGGATGGATGATGG + Intronic
1113919245 13:113897611-113897633 ATAGCTAGTAGGATTGATGATGG + Intergenic
1114497977 14:23147101-23147123 ATGGGTGAATGGATCTATGATGG - Intronic
1114498002 14:23147210-23147232 ATGGATGGATGGATAGATGATGG - Intronic
1114811174 14:25901369-25901391 ATAGATAGATGGATAGATGATGG - Intergenic
1114851016 14:26382504-26382526 ATTGCAAAATGGATGGATCATGG + Intergenic
1115159541 14:30378009-30378031 ATTGATAGATGGATAGATGAAGG + Intergenic
1116700816 14:48239157-48239179 ATGGCAAAATGGACTTATGCAGG + Intergenic
1116712495 14:48386097-48386119 GTAGCTAAACGGATTGATGATGG - Intergenic
1116915712 14:50523599-50523621 ATGCCTGAATGGAGTGAAGAAGG - Intronic
1117580563 14:57147448-57147470 ATGGCTAATTGAATTGATGTAGG + Intergenic
1120107419 14:80512523-80512545 ATGACTGAATGGATTGAAAAAGG - Intronic
1120644905 14:87062539-87062561 ATGGCTAGAGGGATTGGTGAAGG - Intergenic
1121062234 14:90923425-90923447 ATGGATGGATGGATGGATGATGG - Intronic
1121202930 14:92134688-92134710 ATGGCTAAATGTAGTGATTGGGG + Intronic
1121277444 14:92677912-92677934 ATGGATGCATGGATGGATGACGG - Intronic
1121321772 14:92995707-92995729 GTGGCCAAATGGCTTGCTGACGG - Intronic
1121423174 14:93829995-93830017 ATGGATAGATGGATGGATGGTGG + Intergenic
1121603671 14:95224972-95224994 ATGGCTCAATGGTTGGGTGAAGG + Intronic
1122011124 14:98749078-98749100 ATGGATAGATAGATAGATGATGG + Intergenic
1122011540 14:98753092-98753114 ATGGGTGAATGAATGGATGATGG + Intergenic
1122252798 14:100452003-100452025 ATGGATAGTTGGATGGATGATGG - Intronic
1122354980 14:101117546-101117568 ATGGACAGATGGATGGATGATGG - Intergenic
1122355039 14:101117865-101117887 ATGGATGAATGGAATGATGGAGG - Intergenic
1122794171 14:104197497-104197519 GTGGATATATGGATAGATGATGG - Intergenic
1122879911 14:104686051-104686073 ATGGGCAGATGGATGGATGAGGG + Intergenic
1122958315 14:105083072-105083094 ATGGGTGGATGGATGGATGATGG - Intergenic
1122958337 14:105083153-105083175 ATGGGTGGATGGATGGATGATGG - Intergenic
1123083171 14:105705609-105705631 ATGGATGGATGGATGGATGATGG - Intergenic
1124139912 15:27068069-27068091 ATGGCTCAATGGATGGCAGAGGG + Intronic
1124395798 15:29300316-29300338 ATGGATGGATGGATGGATGATGG + Intronic
1125004629 15:34803370-34803392 ATGGCTACATACATTGGTGAAGG - Intergenic
1125732697 15:41902348-41902370 TTGGCTGAATGGATGGATGGAGG - Intronic
1126391733 15:48163323-48163345 TTGGCTTAAGGGAATGATGAGGG - Intronic
1126538318 15:49793618-49793640 ATGGGAAAAAGGATTCATGAAGG + Intergenic
1127696659 15:61455355-61455377 ATGGGTAAATGCTTTGATAATGG - Intergenic
1128230969 15:66034815-66034837 ATGAATTAATGGATTAATGAGGG + Intronic
1128265211 15:66260117-66260139 ATGGATGAATGAATGGATGATGG + Intergenic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128925454 15:71651209-71651231 ATGGCCAACTGGACTGAAGATGG - Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1130353629 15:83111381-83111403 ATGGGTGAATGGGTGGATGATGG - Intronic
1130353638 15:83111423-83111445 ATGGATGAATGGATAGATGATGG - Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1130376954 15:83337826-83337848 ATGAATAAATGAATAGATGAAGG + Intergenic
1130716762 15:86342413-86342435 ATGGTGAAATGAATTAATGAAGG + Intronic
1132030857 15:98437721-98437743 ATGGATGGATGGATGGATGATGG + Exonic
1132030901 15:98437924-98437946 ATGGATAGATGGATGGATGGAGG + Exonic
1132030914 15:98437981-98438003 ATGGATGGATGGATGGATGATGG + Exonic
1132030931 15:98438060-98438082 ATGGATGAATGGATGGATGGAGG + Exonic
1132653668 16:1032611-1032633 ATGGATTGATGGATGGATGATGG - Intergenic
1132653736 16:1032936-1032958 ATGGATGGATGGATGGATGATGG - Intergenic
1132653829 16:1033388-1033410 ATGGATTGATGGATGGATGATGG - Intergenic
1132653854 16:1033506-1033528 ATGGATGGATGGATGGATGATGG - Intergenic
1133204833 16:4227056-4227078 ATGGATGGATGGATGGATGATGG + Intronic
1133204881 16:4227282-4227304 ACAGATAAATGGATGGATGACGG + Intronic
1133229542 16:4360036-4360058 ATGGCTGGATGGATGAATGAGGG - Intronic
1133326811 16:4946989-4947011 ATGGATAGATGGATGGATGGAGG - Intronic
1133326834 16:4947081-4947103 ATGGATGAATGGATGGATGGAGG - Intronic
1133617214 16:7488668-7488690 ATAGATAGATGGATAGATGATGG - Intronic
1134224838 16:12381747-12381769 ATGGGTGCATGGATGGATGATGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134488430 16:14677723-14677745 ATGGATGGATGGATGGATGATGG + Intronic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134766924 16:16767259-16767281 ATGGATAGATGGATGGATGGTGG - Intergenic
1134788004 16:16962459-16962481 ATGGATGGATGGATGGATGAAGG + Intergenic
1135063643 16:19291286-19291308 ATGGATAAAGGAATTAATGAAGG + Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135828833 16:25755001-25755023 ATGGACAGATGGATGGATGATGG - Intronic
1136071358 16:27789417-27789439 ATGGATAGATGGAGGGATGATGG + Exonic
1136071396 16:27789700-27789722 ATGGATGGATGGATGGATGATGG + Exonic
1136071407 16:27789776-27789798 ATGGATGAATGGATAGATAATGG + Exonic
1136071417 16:27789822-27789844 ATGGGTGGATGGATGGATGAAGG + Exonic
1136071442 16:27790003-27790025 ATGGATGGATGGATAGATGATGG + Exonic
1136071449 16:27790060-27790082 ATGGATGAATGGATAGATGATGG + Exonic
1137386165 16:48044316-48044338 GTGGATCAATGGATGGATGATGG - Intergenic
1137601623 16:49760170-49760192 ATGGATGGATGGATGGATGAGGG + Intronic
1137625611 16:49906099-49906121 ATGGATGGATGGATGGATGATGG + Intergenic
1138211849 16:55169748-55169770 ATGGCTAAATCAATTGTTGGTGG + Intergenic
1138244031 16:55453085-55453107 ATGGATAAAGGGATGGATGGAGG - Intronic
1138299414 16:55913784-55913806 ATGACTAAATGCATTCATGAAGG - Intronic
1138440362 16:57030648-57030670 ATGGATGGATGGATGGATGAAGG + Intronic
1138495671 16:57407745-57407767 ATGGATGGATGGATGGATGATGG - Intronic
1138495712 16:57408002-57408024 ATGGGTAGATGGATGGATGGAGG - Intronic
1138547764 16:57729691-57729713 ATGGATGGATGGATGGATGATGG + Intronic
1138547854 16:57730050-57730072 ATGGATGGATGGATGGATGATGG + Intronic
1140917140 16:79504595-79504617 ATGGATAAATGGATAGAGGATGG + Intergenic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1141031992 16:80597079-80597101 GTGGATAGATGGATGGATGATGG + Intergenic
1141110118 16:81265371-81265393 ATGGTTGAATGGATTCATGGTGG - Intronic
1141110130 16:81265422-81265444 ATGGATGAATGGATGGATGGTGG - Intronic
1141110152 16:81265491-81265513 ATGGATAAATGGATTCATGATGG - Intronic
1141110183 16:81265624-81265646 ATGGATGAATGGATGGATGGTGG - Intronic
1141110211 16:81265724-81265746 ATGGATGAATGGATTCATGGTGG - Intronic
1141110219 16:81265783-81265805 GTGGCTCAATGGATGGATGGTGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141483928 16:84326189-84326211 ATGGGTGAATGGATAAATGATGG - Intronic
1141483936 16:84326228-84326250 ATGGGTGAATGGATAAATGATGG - Intronic
1141527420 16:84620591-84620613 TAGGGTAAATGGATTGATCAAGG - Intergenic
1141531088 16:84647822-84647844 ATTGATAGATGGATCGATGAAGG + Intergenic
1141641943 16:85346612-85346634 ATGGATGGATGGATGGATGATGG + Intergenic
1141641988 16:85346821-85346843 ATGGATGGATGGATGGATGATGG + Intergenic
1142152470 16:88518757-88518779 ATGGATGGATGGATGGATGATGG + Intronic
1142152563 16:88519134-88519156 ATGGATGGATGGATGGATGATGG + Intronic
1142244741 16:88964893-88964915 ATGGATAAGTGGATAGATGGTGG - Intronic
1143071395 17:4297276-4297298 ATGAATAAATGGATAGATGGAGG - Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143338391 17:6190544-6190566 AGGACTAAATGAATTGATGTAGG + Intergenic
1143698602 17:8639878-8639900 ATGGCAGTATGGATGGATGAAGG + Intergenic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1143766328 17:9139945-9139967 ATGGATGAATGAATGGATGATGG - Intronic
1144061200 17:11584152-11584174 ATGCCCAGATGCATTGATGAGGG + Intergenic
1144100697 17:11939828-11939850 ATGGATGGATGGATGGATGATGG + Intronic
1144127891 17:12220016-12220038 AAGGCAAAATGAATTGATGCAGG + Intergenic
1144839492 17:18177018-18177040 GTGGATAGATGGATGGATGAAGG + Intronic
1145041829 17:19582785-19582807 ATGGCCAAGTGGATTAAGGACGG + Intergenic
1145042581 17:19587925-19587947 ATGGCCAAGTGGATTAAGGACGG - Intergenic
1145271658 17:21407990-21408012 ATGGATGGATGGATGGATGATGG - Intronic
1145898168 17:28472861-28472883 ATGGATGGATGGATGGATGATGG + Intronic
1145966920 17:28925781-28925803 ATGGCTGGATGGATAGATAATGG + Intronic
1146489233 17:33268319-33268341 ATGGAAAGATGGATGGATGATGG - Intronic
1146489236 17:33268338-33268360 ATGGATGGATGGATGGATGATGG - Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146820919 17:35983065-35983087 ATGGATGGATGGATGGATGAAGG - Intergenic
1148235987 17:45969479-45969501 ATGTATAATTGGATGGATGATGG - Intronic
1148982742 17:51592995-51593017 AGGTAGAAATGGATTGATGATGG + Intergenic
1149129381 17:53278920-53278942 AAGGCTAATTGGATAGATCAAGG - Intergenic
1149743358 17:59069767-59069789 AAGGCTAAATGAGTTGATAATGG + Intronic
1150631426 17:66883050-66883072 ATGGAAGAATGGATGGATGATGG - Intronic
1151419548 17:73988174-73988196 TTGGCTCACTCGATTGATGAGGG + Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152345137 17:79746895-79746917 ATGGATAAATGAATGCATGAGGG + Intergenic
1153493596 18:5674880-5674902 ATGGCTAAAGGTATTAATAATGG + Intergenic
1153605253 18:6826940-6826962 ATGGTTAAATGGATTAAGGGTGG - Intronic
1155190596 18:23426141-23426163 ATATCTAAATGGTTTTATGATGG + Intronic
1155539319 18:26850728-26850750 ATGGATGGATGGATGGATGATGG - Intergenic
1156471675 18:37380999-37381021 ATGGATAGATGGATGGATGGTGG - Intronic
1156471694 18:37381107-37381129 ATGGATGGATGGATGGATGATGG - Intronic
1156918558 18:42490478-42490500 AGGTCTAAATGGATTGCTCAGGG + Intergenic
1157287420 18:46386539-46386561 ATGGATGGATGGATTGATGGGGG - Intronic
1159024130 18:63167316-63167338 AAGGCTAGATGGATGGATGATGG - Intronic
1160502519 18:79409294-79409316 ATGGAGGAATGGATGGATGATGG - Intronic
1160502561 18:79409525-79409547 GTGGATGAATGGATGGATGATGG - Intronic
1160526583 18:79542188-79542210 GTGGGTGGATGGATTGATGAAGG - Intergenic
1160681774 19:414971-414993 ATGGATAGATGGAATAATGATGG + Intergenic
1160709562 19:544806-544828 ATGGGTAGAGGGATGGATGATGG - Intronic
1160767822 19:816274-816296 ATGGCTGCATGGGTGGATGATGG - Intronic
1160767963 19:816861-816883 ATGGCTGCATGGGTGGATGATGG - Intronic
1160926593 19:1549637-1549659 ATGGATGGATGGATGGATGAAGG - Intergenic
1161049782 19:2157095-2157117 ATGGATGGATGGATGGATGATGG - Intronic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161449092 19:4334667-4334689 ATGGATAGATGGATGGATGGGGG - Intronic
1161449122 19:4334806-4334828 ATGGATGAGTGGATGGATGATGG - Intronic
1161657498 19:5525098-5525120 ATGGGTGAATGGATGGATGATGG - Intergenic
1161681463 19:5681764-5681786 ATGGGTGGATGGATGGATGATGG - Intronic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1161934620 19:7364035-7364057 ATGGATAAATGAATGAATGAAGG + Intronic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1162085825 19:8248597-8248619 ATGGGTAGGTGGATGGATGATGG + Intronic
1162085912 19:8249017-8249039 ATGGGTGGATGGATGGATGATGG + Intronic
1162161318 19:8720102-8720124 ATGGTTAGAGGGATGGATGATGG - Intergenic
1162180783 19:8867388-8867410 AAGGATAGATGGATGGATGATGG + Intronic
1162203318 19:9037031-9037053 ATGGCTGCATGGATGGAAGAAGG + Intergenic
1163050793 19:14682252-14682274 ATGGATGGATGGATTGATGATGG - Intronic
1163218175 19:15895988-15896010 ATGGATGGATGGATGGATGATGG - Intronic
1163262060 19:16197304-16197326 ATGACTCAATGGATTAATCAAGG + Intergenic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163382631 19:16978931-16978953 ATGGATAAATGGATGGATGGTGG - Intronic
1163383546 19:16985272-16985294 GTGGATGAATGGATGGATGAAGG + Intronic
1163383586 19:16985456-16985478 ATGGATGGATGGATGGATGAAGG + Intronic
1163409629 19:17145936-17145958 ATGGATGGATGGATGGATGATGG + Intronic
1163462268 19:17446181-17446203 ATGGATGGATGGATGGATGAGGG - Intronic
1163493917 19:17633578-17633600 GTGGGTGAATGAATTGATGAAGG - Intronic
1163571336 19:18084048-18084070 ATGGGTAAATGGGTGGATGGTGG - Intronic
1164678878 19:30120987-30121009 ATGGGTAGGTGGATGGATGATGG - Intergenic
1164678924 19:30121216-30121238 ATGGATGAATGGATTGATGGGGG - Intergenic
1164703060 19:30299793-30299815 ATGGCATAATGGATTAATTAAGG - Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164718159 19:30408750-30408772 AAGGATAGATGGATGGATGATGG - Intronic
1164797296 19:31044403-31044425 ATGGATGGATGGATGGATGAAGG + Intergenic
1164797309 19:31044515-31044537 ATGGCTGAATGGATGGATGAAGG + Intergenic
1164814821 19:31188650-31188672 ATGACTAAATGGATTATTAATGG - Intergenic
1165144390 19:33722093-33722115 ATGGATGGATGGATGGATGAAGG + Intronic
1165190314 19:34057442-34057464 ATGGGTAGATGGATGGATGATGG + Intergenic
1165654385 19:37520540-37520562 ATGGCTAAATGAAGGGAGGATGG + Intronic
1165787073 19:38468045-38468067 ATGGATGGATGGATGGATGATGG - Intronic
1165787101 19:38468204-38468226 ATGGATGGATGGATGGATGATGG - Intronic
1166396060 19:42442064-42442086 ATGGCTAAACTTAATGATGATGG - Intronic
1166647678 19:44544195-44544217 ATGGATGGATGGATGGATGACGG - Intergenic
1167161410 19:47769682-47769704 ATGGATGGATGGATAGATGATGG - Intergenic
1167161417 19:47769727-47769749 ATGGATGGATGGATGGATGATGG - Intergenic
1167161425 19:47769762-47769784 ATGGATGGATGGATGGATGATGG - Intergenic
1167168964 19:47818337-47818359 ATGGATGGATGGATGGATGATGG - Intronic
1167277626 19:48548433-48548455 ATGGATGAATGGATAGATGAAGG + Intergenic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167389007 19:49181981-49182003 ATGGATGAATGGATAGATGGAGG - Intronic
1167556046 19:50196394-50196416 ATGGATGGATGGATGGATGATGG - Intronic
1167601287 19:50456289-50456311 ATGGATGGATGGATGGATGATGG - Intronic
1168330930 19:55568082-55568104 ATGCATAGATGGATGGATGATGG + Intergenic
1168472044 19:56647843-56647865 ATGGGTAGATGGATTTATGAAGG - Intronic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925541185 2:4969547-4969569 ATGGATGGATGGATGGATGATGG - Intergenic
925697102 2:6592096-6592118 ATAGATAAATGGATGGATGATGG - Intergenic
925745344 2:7039073-7039095 ATGGATGAATGGGTAGATGATGG + Intronic
925745379 2:7039263-7039285 ATGGATGAATGGGTAGATGATGG + Intronic
925745396 2:7039360-7039382 ATGGATGAATGGGTAGATGATGG + Intronic
925925640 2:8668184-8668206 ATGGGTGAATGGATGGATAAAGG + Intergenic
925925677 2:8668372-8668394 ATGGATGGATGGATGGATGAAGG + Intergenic
925925698 2:8668472-8668494 AGGGATGGATGGATTGATGAAGG + Intergenic
926051555 2:9748141-9748163 ATGGATTAATGGATTCATGAGGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927101491 2:19790723-19790745 AAGGCTGAATGGATTCATGTGGG + Intergenic
927197747 2:20559732-20559754 ATGGATGGATGGATGGATGATGG + Intergenic
928177512 2:29044965-29044987 ATGGATGGATGGATGGATGATGG - Intronic
928695203 2:33842022-33842044 ATGGCTATAATGATTAATGATGG - Intergenic
929110873 2:38404122-38404144 AGGGTTAAATGGATTAATGGTGG + Intergenic
929517865 2:42621384-42621406 AGGGTTAAATGGATTAATGGCGG - Intronic
929926695 2:46218197-46218219 ATGGATAAATGGATGAATAATGG - Intergenic
931972339 2:67602639-67602661 ATGGATGGATGGATGGATGATGG + Intergenic
931998851 2:67865076-67865098 GTGGCTAGATGGATGGATAAAGG + Intergenic
933248208 2:79999314-79999336 GTGGCTAGATGGAATGAAGAAGG - Intronic
933848415 2:86346161-86346183 AGGGTTAAATGGATTAAGGATGG - Intergenic
935023299 2:99252577-99252599 ATGGATAGTTGGATGGATGAAGG + Intronic
935782322 2:106519059-106519081 ATGGATGGATGGATGGATGATGG - Intergenic
935841616 2:107117916-107117938 ATTGATTAATGGATTGATAAGGG - Intergenic
936243980 2:110810636-110810658 ATGGATGGATGGATGGATGATGG - Intronic
936244649 2:110816197-110816219 ATGGGTAGATGGATAAATGATGG + Intronic
936692658 2:114911316-114911338 ATGAGTAAATGGATTCATTAGGG - Intronic
936956991 2:118032435-118032457 ATGGGTGGATGGATGGATGAAGG + Intergenic
937207231 2:120244613-120244635 ATGGATGGATGGATGGATGAGGG - Intronic
937354403 2:121188910-121188932 ATGAGTGAATGGATAGATGAAGG + Intergenic
938169566 2:129062963-129062985 ATGGATGGATGGATGGATGATGG - Intergenic
938562630 2:132488512-132488534 ATGACTAAATGGAGTGGTGGTGG + Intronic
938905135 2:135829959-135829981 ATGGCTAAATGAATGCGTGAAGG + Intronic
939237271 2:139512219-139512241 ATGGATGAATGGATAGAGGAGGG - Intergenic
939931042 2:148233292-148233314 AGGGTTCTATGGATTGATGAAGG - Exonic
940756595 2:157689916-157689938 CTAGCTAAAATGATTGATGAAGG - Intergenic
941646467 2:168046509-168046531 ATGGCAAGATGGCTTGATGTGGG - Intronic
941801819 2:169668084-169668106 CTGGCTAAAATCATTGATGAAGG - Intronic
942462893 2:176181352-176181374 ATGGCTAAATGAATTGTGGCAGG + Intergenic
943412045 2:187557642-187557664 AGGGCTAAATGGATTAAGGGCGG + Intronic
943578215 2:189654220-189654242 AGGGCTAAATGGATTAAGGGCGG + Intergenic
943810043 2:192173810-192173832 ATGGCTTAAAGTATTGATGGTGG - Intronic
946187210 2:217987874-217987896 GTGGGTGAATGGATGGATGAGGG + Intronic
946216838 2:218190653-218190675 ATGGCTATAGGGATGGATAATGG + Intergenic
946952364 2:224891056-224891078 ATGTCTAGAAGGATGGATGATGG + Intronic
947233680 2:227918168-227918190 ATGGATGGATGGATGGATGATGG - Intronic
947998123 2:234545337-234545359 AAAGCTAAATGGATTGATTTTGG + Intergenic
948532004 2:238614926-238614948 ATGGATAAGTGGATGGATGGGGG - Intergenic
948652749 2:239458745-239458767 ATGGATTAATGCATTCATGAGGG + Intergenic
948665793 2:239534108-239534130 ACGGCTAAATGGAGGAATGAGGG - Intergenic
949065854 2:241990011-241990033 ATGGATGGATGGATGGATGATGG - Intergenic
949065863 2:241990054-241990076 ATGGGTGGATGGATGGATGATGG - Intergenic
1168812901 20:717831-717853 ATGGATAAATGGGTTCATGGAGG - Intergenic
1169081899 20:2802367-2802389 TTGGCCAAATTGATTGATTAGGG - Intergenic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170440377 20:16373396-16373418 ATGTTTAAATGGAGTGAAGAAGG + Intronic
1171037373 20:21726519-21726541 ATGGCTTAATCCATTCATGAAGG + Intergenic
1171227085 20:23451028-23451050 ATGGGTAAATGGATGGATGGGGG - Intronic
1171405713 20:24911078-24911100 ATGGATAAATGGATAGATACAGG + Intergenic
1172184908 20:33025436-33025458 ATGGATGAATGAATGGATGATGG - Intergenic
1172203981 20:33148922-33148944 ATGGATGGATGGATGGATGATGG + Intergenic
1172338171 20:34133411-34133433 ATGGTTAAATGGATTAAGGGTGG + Intergenic
1172379135 20:34474416-34474438 ATGGTTAAATGGATTAAGGGCGG - Intronic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1172780837 20:37436222-37436244 ATGGGAACATGGATGGATGATGG - Intergenic
1172919510 20:38469413-38469435 ATGGATGGATGGATGGATGAGGG - Intergenic
1172923757 20:38511585-38511607 AGGGTTAAATGGATTAATGGCGG - Intronic
1173823630 20:46033710-46033732 ATGGGTGAATGGTTGGATGATGG - Intronic
1173871501 20:46344909-46344931 ATGGATGGATGGATGGATGATGG - Intergenic
1174577323 20:51545728-51545750 ATGGAAGAATGGATGGATGATGG + Intronic
1174692494 20:52521317-52521339 ATTGCTAAGTTAATTGATGAAGG - Intergenic
1174746942 20:53072906-53072928 AGGGATGAATGGATGGATGAAGG - Intronic
1174747037 20:53073293-53073315 ATGGATGGATGGATGGATGAAGG - Intronic
1175108983 20:56632553-56632575 CTGCTTAAATGGATTGAGGATGG + Intronic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175165307 20:57039325-57039347 ATGGATGATTGGATAGATGATGG + Intergenic
1175165322 20:57039411-57039433 ATGGATGGATGGATGGATGATGG + Intergenic
1175421738 20:58839304-58839326 ATGGCTTAATAGTTTGAGGATGG - Intergenic
1175493216 20:59393271-59393293 AAGGATGAATGGATGGATGAAGG - Intergenic
1175526618 20:59638826-59638848 ATGGATGGATGGGTTGATGATGG + Intronic
1175754151 20:61518765-61518787 ATGGATGAAAGGATGGATGATGG - Intronic
1175754158 20:61518807-61518829 ATGGATTAATGGATGGATGATGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779195 20:61671645-61671667 ATGGGTGAATGGATGGATAATGG + Intronic
1175779223 20:61671783-61671805 ATGGATCGATGGATAGATGATGG + Intronic
1175798470 20:61787095-61787117 ATGGATGGATGGATGGATGATGG - Intronic
1175799005 20:61790401-61790423 ATGGATAGATGGGTAGATGAGGG - Intronic
1175817211 20:61889457-61889479 ATGGATGGATGGATAGATGATGG + Intronic
1175817287 20:61889890-61889912 ATGGATGGATGGATAGATGATGG + Intronic
1175817291 20:61889913-61889935 ATGGGTAGATGGATCGATGATGG + Intronic
1176047135 20:63098574-63098596 ATGGACAGATGGATGGATGATGG + Intergenic
1176047150 20:63098702-63098724 ATGGATAAATGAATGGATGATGG + Intergenic
1176933262 21:14839391-14839413 AGAGCTAAGTGGATTGTTGAAGG + Intergenic
1178666274 21:34549801-34549823 ATGGATGGATGGATGGATGATGG - Intronic
1178873053 21:36392178-36392200 AGGGTTAAATGGATTAAGGACGG - Intronic
1179017465 21:37605653-37605675 ATGGATGGATGGATGGATGAAGG - Intergenic
1179474765 21:41636110-41636132 GTGGATGAATGGATGGATGATGG - Intergenic
1179551031 21:42144151-42144173 ATGGTTAGATGGGTGGATGAAGG - Intergenic
1179715365 21:43283875-43283897 ATGGATAGATGAATAGATGATGG - Intergenic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180025105 21:45156380-45156402 ATGGATGGATGGATGGATGATGG - Intronic
1181958982 22:26609478-26609500 ATGGATAAAGGGATGGATGAAGG + Intronic
1182039062 22:27222259-27222281 ATGGGTGAATGAATGGATGATGG + Intergenic
1182039081 22:27222380-27222402 ATGGGTGAATGGATGGATGATGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182099733 22:27649414-27649436 ATGGATGGATGGATGGATGATGG + Intergenic
1182862079 22:33568868-33568890 ATGGATGGATGGATGGATGATGG + Intronic
1183106479 22:35618729-35618751 ATGGATAGATGGATAGATGGAGG - Intronic
1183106491 22:35618796-35618818 ATGGATGAATGGAGGGATGATGG - Intronic
1183303932 22:37071974-37071996 ATGGATGGATGGATGGATGATGG + Intronic
1183303966 22:37072144-37072166 ATGGGTGAATGGATGGATGATGG + Intronic
1183303979 22:37072216-37072238 ATGGATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304003 22:37072341-37072363 ATGGATGGATGGATGGATGATGG + Intronic
1183304027 22:37072467-37072489 ATGGATGGATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304042 22:37072561-37072583 ATGGATGGATGGATGGATGATGG + Intronic
1183304049 22:37072595-37072617 ATGGATGGATGGATGGATGATGG + Intronic
1183304090 22:37072798-37072820 ATGGATGGATGGATGGATGATGG + Intronic
1183304098 22:37072840-37072862 ATGGATGGATGGATGGATGATGG + Intronic
1183304128 22:37073010-37073032 ATGGATGGATGGATGGATGATGG + Intronic
1183304136 22:37073044-37073066 ATGGGTGGATGGATGGATGATGG + Intronic
1183321929 22:37170114-37170136 ATGGATGGATGGATGGATGAAGG + Intronic
1183600024 22:38834597-38834619 ATGGATGGATGGATGGATGATGG - Intronic
1184293097 22:43508664-43508686 ATGGATGAATGCATGGATGATGG - Intergenic
1184293186 22:43508968-43508990 ATGGATAGATGGATGGATGGGGG - Intergenic
1184293234 22:43509115-43509137 ATGGTTAGATGGATAGATGGAGG - Intergenic
1184321289 22:43743991-43744013 ATGGATGAATGAATGGATGAAGG + Intronic
1184389422 22:44194778-44194800 ATGGATGGATGGATAGATGATGG - Intronic
1184414710 22:44345560-44345582 ATGGCTAGATGGATAGACAATGG + Intergenic
1184434281 22:44460604-44460626 GTGGGTAGATGGATGGATGAGGG - Intergenic
1184930765 22:47679633-47679655 ATGGATGGATGGATGGATGATGG - Intergenic
1184930769 22:47679652-47679674 ATGGATGGATGGATGGATGATGG - Intergenic
1184996775 22:48212978-48213000 ATGGATGGATGGATGGATGATGG - Intergenic
1184996801 22:48213159-48213181 ATGGCTAGATGGATGGATGGGGG - Intergenic
1185053514 22:48566062-48566084 ATGGATGGATGGATGGATGATGG + Intronic
1185076691 22:48687020-48687042 ATGGATGGATGGATTGATGGAGG + Intronic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
1185196815 22:49476870-49476892 ATGGATGGATGGATGGATGATGG + Intronic
1185196996 22:49477630-49477652 ATGGATGGATGGATGGATGATGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
949887808 3:8710218-8710240 ATGGGTAAATGGACTTACGAAGG - Intronic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950287370 3:11755381-11755403 AGGACTAAAGGGATTGAGGAAGG + Intergenic
950470513 3:13182453-13182475 ATTGCTACATCGATAGATGATGG + Intergenic
950526879 3:13529407-13529429 AGGGAGAAATGGATGGATGATGG - Intergenic
950573508 3:13816770-13816792 ATGGGTAGATGGATGGATGAAGG - Exonic
951748917 3:26012181-26012203 ATAGATAAAGGGATTGAAGAGGG - Intergenic
951836096 3:26984944-26984966 ATGGATAAATGGTTGGATTAAGG + Intergenic
952307669 3:32160308-32160330 ATGGGTGAATGGATGGATGATGG + Intronic
952307703 3:32160427-32160449 ATGGGTGAATGGATGGATGATGG + Intronic
952307733 3:32160533-32160555 ATGGGTGAATGGATGGATGATGG + Intronic
953324922 3:42004826-42004848 ATGGCTAAAGAGATGGATGGGGG + Intergenic
953531157 3:43740830-43740852 ATGGTTAAGTGGATTGATGATGG - Intergenic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
955122096 3:56070923-56070945 ATGGCTAAATTGAGAGATGAGGG - Intronic
955385357 3:58474932-58474954 ATGGACGAATGGATGGATGAAGG - Intergenic
955410463 3:58652414-58652436 ATGGCTAGATGGGTAGATGGTGG - Intronic
955410522 3:58652659-58652681 ATGGCTGGATGGATAGATGGAGG - Intronic
960367728 3:116794155-116794177 ATGGATGGATGGATGGATGAAGG + Intronic
962788070 3:138785558-138785580 AGGGTTAAATGGATTAAGGACGG + Intronic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
963219493 3:142792166-142792188 ATAGATAAATGGTTTGATAAAGG + Intronic
963704353 3:148666985-148667007 ATGGATAGTTGGATGGATGAAGG + Intergenic
964823385 3:160798239-160798261 ATTGCTAAAATAATTGATGAAGG + Intronic
964898438 3:161627353-161627375 ATGACTAGATGAACTGATGAGGG + Intergenic
965695903 3:171407899-171407921 ATTGCTGAAGGGATTGAAGACGG - Intronic
966567465 3:181398862-181398884 ATGGATGAATGGGTGGATGATGG + Intergenic
968594669 4:1476243-1476265 ATGGGTAGATGGATGGATGGTGG + Intergenic
968766307 4:2471959-2471981 ATAGCTAAAATAATTGATGAAGG + Intronic
969256760 4:6007700-6007722 ATAGGTAGATGGATGGATGATGG + Intergenic
969424797 4:7117963-7117985 ATGGATGAATGGATGGATGGAGG + Intergenic
969424879 4:7118333-7118355 ATGGATAAATGCATGGATGATGG + Intergenic
969424915 4:7118515-7118537 ATGGATAAATGCATGGATGATGG + Intergenic
969424958 4:7118718-7118740 ATGGATAAATGCATGGATGATGG + Intergenic
969465126 4:7351799-7351821 ATGGATGAATGGATGGGTGATGG - Intronic
969465130 4:7351818-7351840 ATGGGTGAATGGGTAGATGATGG - Intronic
969501608 4:7556808-7556830 ATGGGTAGATGGATGGATGATGG - Intronic
969510410 4:7614441-7614463 ATGGGTGAATGGATGGATTATGG - Intronic
969510436 4:7614575-7614597 ATGGGTGGATGGATTCATGATGG - Intronic
969612188 4:8233603-8233625 ACAGGTAAATGGATAGATGATGG - Intronic
969612237 4:8233851-8233873 ATAGGTGAATGGATGGATGATGG - Intronic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969612300 4:8234220-8234242 ATGGGTGAATGGATGGATGATGG - Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
969874794 4:10128128-10128150 AGGGTTAAATGGATTAAGGACGG - Intergenic
970976279 4:22046580-22046602 ATAGATAAATCCATTGATGAGGG - Intergenic
971127399 4:23769385-23769407 ATGGATGGATGGATGGATGATGG - Intronic
972368135 4:38394960-38394982 ATGGATAGATGGATGGATGGAGG + Intergenic
972995616 4:44875460-44875482 AAGGCTTAATGGATTGAAGTTGG - Intergenic
974339504 4:60597001-60597023 AAGGCTAAATGAGTTGATAAGGG + Intergenic
975245281 4:72113403-72113425 ATGGCTAAATGGATTGATGAAGG - Intronic
976075547 4:81295227-81295249 ATGGATGGATGGATGGATGATGG + Intergenic
977430509 4:96926279-96926301 CTTGCTAAATAGATTGGTGAGGG + Intergenic
977623964 4:99169768-99169790 ATGGCCAGATGGATTCATGGCGG - Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
979971000 4:127135177-127135199 ATGGATGAATGAATGGATGAAGG + Intergenic
982523673 4:156451611-156451633 ATGGAAAAATGGATTGTTCAGGG - Intergenic
983086938 4:163457496-163457518 ATGACTAAATGGACTAATGGGGG - Intergenic
983370830 4:166855967-166855989 AAGGTTAAATGGATTAATGTAGG + Intronic
983464694 4:168072706-168072728 CTGGCTAAAGTAATTGATGAAGG - Intergenic
984004630 4:174294296-174294318 AGGGTTAAATGGATTAATGGTGG - Intronic
985188749 4:187347400-187347422 ATGGGTGAATAGATAGATGATGG - Intergenic
985547612 5:517901-517923 ATGGATGGATGGATGGATGATGG - Intronic
985709152 5:1418599-1418621 ATGGGTGGATGGATGGATGATGG - Intronic
985709158 5:1418622-1418644 ATGGATGGATGGATCGATGATGG - Intronic
985709173 5:1418704-1418726 ATGGATGGATGGATGGATGATGG - Intronic
985709183 5:1418739-1418761 ATGGATGGATGGATGGATGATGG - Intronic
987067999 5:14308515-14308537 ATGGATAAATGGATGGAGGTTGG - Intronic
988041161 5:25890627-25890649 AAGACTGAATCGATTGATGAGGG + Intergenic
988053457 5:26060019-26060041 ATGGCTAGATGCATAAATGAAGG - Intergenic
988307363 5:29509699-29509721 ATGGCCCAATCCATTGATGAGGG - Intergenic
988834023 5:35014019-35014041 ATGGCTAAAGGGATTGGGAATGG - Exonic
990364069 5:55051665-55051687 TTGGCAAAATGAACTGATGAAGG + Intergenic
990631609 5:57676384-57676406 ATGGCTAAATGGCTTTTTAATGG - Intergenic
991113018 5:62923155-62923177 ATGTTTAAATGGATTGTTAAAGG + Intergenic
991373489 5:65941058-65941080 AGGGTTAAATGGATTAATGGTGG + Intronic
992462086 5:76970534-76970556 ATGGATGGATGGATGGATGACGG + Intronic
993043210 5:82838493-82838515 AGGGCTAAATGATTTGCTGATGG - Intergenic
993096417 5:83484322-83484344 ATGGATGAATAGATAGATGATGG - Intronic
994252763 5:97556186-97556208 ATAGATAAATGGATGAATGATGG + Intergenic
995635042 5:114178602-114178624 AAGGCTAAATGAATTGAAGTGGG - Intergenic
996892565 5:128439384-128439406 ATGGCAAACTGTATTGGTGAGGG - Intronic
997189104 5:131913986-131914008 ATGGCTTAATCCATTTATGAAGG - Intronic
999325196 5:150639424-150639446 GAGTCTGAATGGATTGATGAGGG + Intronic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999564292 5:152840051-152840073 ATTCCTAAAAGAATTGATGAGGG - Intergenic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
999935829 5:156485137-156485159 ATGTCTAAAAGGTTTGGTGAGGG - Intronic
1000119356 5:158181694-158181716 ATGGCTAGATGGATAGAAGATGG - Intergenic
1000450801 5:161384500-161384522 ATGGCTGAATGGCTGGATAAAGG - Intronic
1000937762 5:167323280-167323302 ATGGCTAAATGGATAGTAGGCGG + Intronic
1000948381 5:167450047-167450069 ATGGATGGATGGATGGATGATGG + Intronic
1001435457 5:171695939-171695961 ATGGATGGATGGATGGATGATGG + Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001701737 5:173711741-173711763 ATGGATGGATGGATGGATGATGG + Intergenic
1001751435 5:174134546-174134568 ATGGATGGATGGATGGATGATGG - Intronic
1001751445 5:174134588-174134610 ATGGGTGAATGGATGGATGATGG - Intronic
1001751465 5:174134706-174134728 ATGGGTGGATGGATGGATGATGG - Intronic
1001751483 5:174134820-174134842 ATGGATGGATGGATGGATGATGG - Intronic
1001863515 5:175081714-175081736 CTGGCTAACTGGATTAATAATGG + Intergenic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002210162 5:177594032-177594054 TTGGCTAAATGAACAGATGAAGG + Intronic
1002298682 5:178245733-178245755 ATAGATGAATGGATTGTTGATGG - Intronic
1002303300 5:178269547-178269569 ATGGATGGATGGATGGATGATGG - Intronic
1002439099 5:179255001-179255023 ATGGATGGATGGATGGATGATGG + Intronic
1003601920 6:7525735-7525757 AAGGATAAATGGATAGATGGCGG + Intergenic
1004388595 6:15190312-15190334 AGGGTTAAATGGATTGAGGGCGG + Intergenic
1005783288 6:29216315-29216337 AGGGCCCAATTGATTGATGAAGG - Intergenic
1006338534 6:33433260-33433282 GTGGCTGAATGAATGGATGATGG + Intronic
1006976573 6:38107853-38107875 ATTGCTTGATTGATTGATGAAGG + Intronic
1007364018 6:41377544-41377566 ATGGCTAAAAGGGATTATGAAGG + Intergenic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1008483883 6:52014618-52014640 CTGGATAAATGGATGGATCATGG + Intronic
1008916930 6:56798122-56798144 CTGGCTAAAATCATTGATGAAGG + Intronic
1009392995 6:63164947-63164969 AGGGCTAAATGGATTAAGGACGG + Intergenic
1010176535 6:73033932-73033954 AAAGCTAGCTGGATTGATGATGG + Intronic
1010264283 6:73850681-73850703 AGGGTTAAATGGATTGAGGGCGG - Intergenic
1010583151 6:77624075-77624097 ATGGATTAATCAATTGATGAAGG + Intergenic
1011033982 6:82953608-82953630 ATGGCTGGATGGGTGGATGAAGG - Intronic
1011981128 6:93380112-93380134 AGGGTTAAATGGATTAATAATGG - Intronic
1012397079 6:98810934-98810956 ATGGATGAATGGATGGCTGATGG + Intergenic
1013606306 6:111752242-111752264 ATGGGTAGATGGATAGATGGAGG - Intronic
1014567861 6:122972747-122972769 CTTGCACAATGGATTGATGATGG + Intergenic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1016317784 6:142808812-142808834 AGGGATAAATGGATGGATGGTGG + Intronic
1016539474 6:145148185-145148207 CTGGCTAACTGGGGTGATGAAGG + Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1017821766 6:158054062-158054084 ATGGCTGAATGGATGGATAATGG - Intronic
1018216773 6:161535920-161535942 CTGGCTAAATGGATTGTAGTAGG - Intronic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1018853066 6:167655061-167655083 ATGGATGGATGGATGGATGATGG + Intergenic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019326973 7:443292-443314 ATGGATAGATGGATGGATGGTGG + Intergenic
1019326979 7:443331-443353 ATGGATAGATGGATTGATGGAGG + Intergenic
1019369893 7:656509-656531 ATGACTAAATGTATGGATAAGGG + Intronic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019503692 7:1379584-1379606 ATGGATGGATGGATGGATGATGG + Intergenic
1019567252 7:1690425-1690447 ATGGGTGAATGGATGGATGAAGG + Intronic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019567328 7:1690785-1690807 ATGGGTGAATGGATGGATGAAGG + Intronic
1019704598 7:2491469-2491491 ATGGATGGATGGATGGATGATGG - Intergenic
1019914668 7:4125069-4125091 ATGGATGGATGGATGGATGATGG + Intronic
1019914725 7:4125361-4125383 ATGGATGAATGGATGGGTGATGG + Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1019932054 7:4230291-4230313 ATGGATGAATGAATTGATGAAGG + Intronic
1020951407 7:14682945-14682967 GTGGCTGATTGGATTGATTAGGG - Intronic
1022409399 7:30126439-30126461 AAGGCTAAATGAACTGATGAGGG + Intronic
1022477237 7:30719598-30719620 ATGGATGGATGGATGGATGATGG - Intronic
1022512369 7:30947845-30947867 ATGGCAAAAAGGATTGAAGGAGG - Intronic
1024846207 7:53645319-53645341 ATAGATAAATGGATAGATTATGG - Intergenic
1026161169 7:67870061-67870083 ATGGATGAATGGATGGATGGAGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026275120 7:68869941-68869963 AAGGATAAATGGATGGATGGTGG + Intergenic
1026275141 7:68870027-68870049 ATGGATGAATGGATAGATGGTGG + Intergenic
1026275203 7:68870310-68870332 ATGGAAAGATGGATGGATGATGG + Intergenic
1026275212 7:68870368-68870390 ATAGATGAATGGATGGATGATGG + Intergenic
1026319638 7:69257610-69257632 ATGGATGGATGGATGGATGACGG + Intergenic
1026408956 7:70099078-70099100 ATGACTAAAAGGAATCATGACGG - Intronic
1028097453 7:86779495-86779517 TTTGTTAAATGGATTGATGAGGG - Intronic
1029599728 7:101556647-101556669 ATGGATGGATGGATGGATGATGG + Intronic
1029604861 7:101592455-101592477 ATGGATGGATGGATGGATGATGG - Intergenic
1030075635 7:105733929-105733951 ATGGATGGATGGATGGATGATGG - Intronic
1030494564 7:110282571-110282593 ATGTCTAAATGGGGAGATGATGG - Intergenic
1031496776 7:122459241-122459263 ATGGATAATTGGATTAATTATGG - Intronic
1031888486 7:127265849-127265871 ATGGATGCATGGATGGATGATGG + Intergenic
1032725165 7:134584346-134584368 ATGGATGAATGGATGGATGGAGG + Intergenic
1032725212 7:134584556-134584578 ATGGATAAATGGATGGAAGCAGG + Intergenic
1033283541 7:140022259-140022281 ATGGCCAGATTGCTTGATGACGG - Intergenic
1033574394 7:142666312-142666334 TTGGGTAAATGGTTTGATTAAGG - Exonic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1034883646 7:154781049-154781071 ATGGGTGGATGGATGGATGATGG + Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035320161 7:158023749-158023771 ATGACTGAGTGGCTTGATGAGGG - Intronic
1035452640 7:158988179-158988201 ATGGATGGATGGATAGATGATGG - Intergenic
1036476247 8:9096056-9096078 CTGTCTAAATGTATTGCTGAGGG + Intronic
1036641674 8:10588505-10588527 ATAGATAGGTGGATTGATGATGG - Intergenic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036724836 8:11210603-11210625 ATGCCCACATGTATTGATGAGGG + Intergenic
1037669732 8:21004047-21004069 ATGGATAGATGGATAGATGGAGG + Intergenic
1038295717 8:26289829-26289851 AAGGCTGAATGGAGTGATAAAGG - Intergenic
1038440769 8:27569564-27569586 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440777 8:27569604-27569626 ATAGATAAAGGGATGGATGAAGG + Intergenic
1038440882 8:27570040-27570062 ATGGTTGGATGGATGGATGAAGG + Intergenic
1038440892 8:27570096-27570118 ATGGTTGGATGGATGGATGAAGG + Intergenic
1038440910 8:27570180-27570202 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440913 8:27570192-27570214 ATGGATGAAGGGATGGATGAAGG + Intergenic
1038440918 8:27570216-27570238 ATGGATGCATGGATGGATGAAGG + Intergenic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1039411141 8:37356244-37356266 ATGGCTAGATGGATGCATGTGGG + Intergenic
1041010257 8:53534936-53534958 ATGGATGGATGGATGGATGATGG + Intergenic
1042215343 8:66425437-66425459 ATGGATGGATGGATGGATGAAGG + Intergenic
1042355310 8:67821591-67821613 ATGGATGGATGGATAGATGAAGG - Intergenic
1043957189 8:86374425-86374447 ATGGCTAAATGTATGTAAGAAGG - Intronic
1044112707 8:88296116-88296138 ATGAATAAATGGATGAATGATGG - Intronic
1044327745 8:90878681-90878703 ATGAATAAATGGATGAATGAAGG + Intronic
1045068658 8:98477554-98477576 ATGGCTGAATGAATTGCTAATGG - Intronic
1045189777 8:99871321-99871343 ATGGGTAACTGGATTGGTGAGGG + Intronic
1046087774 8:109460410-109460432 ATGGATAGATGGAATGATGGGGG + Intronic
1046112171 8:109738478-109738500 ATGGATGGATGGATGGATGAGGG - Intergenic
1047187207 8:122644695-122644717 ATGGCTAACTGGATGGCTAAAGG + Intergenic
1047306774 8:123659037-123659059 ATGGCTGAATGAATGGATGATGG - Intergenic
1047306815 8:123659252-123659274 ATGGATGGATGGATAGATGATGG - Intergenic
1047306872 8:123659551-123659573 ATAGATGAATGGATAGATGATGG - Intergenic
1047306882 8:123659609-123659631 ATGGATGGATGGATAGATGATGG - Intergenic
1047306897 8:123659744-123659766 ATGGATGGATGGATGGATGATGG - Intergenic
1047306906 8:123659783-123659805 ATGGATGAATGGATAGATGATGG - Intergenic
1048176773 8:132159846-132159868 ATGGATGAATGGGTGGATGATGG - Intronic
1048648424 8:136448331-136448353 AAGGCTAGATGGGTTAATGAGGG - Intergenic
1049042181 8:140120835-140120857 ATGGATGGATGGATGGATGATGG - Intronic
1049348396 8:142151241-142151263 ATGGATAAGTGGATGGGTGATGG + Intergenic
1049350562 8:142162246-142162268 ATGGGTAAATGGATAGAGGATGG + Intergenic
1049350926 8:142164221-142164243 ATGGATGGATGGATGGATGAAGG + Intergenic
1049364289 8:142229240-142229262 ATGGATGAATGGATGGATGGTGG + Intronic
1049364317 8:142229364-142229386 ATGGATAGATGGATGGATGGTGG + Intronic
1049576539 8:143392389-143392411 ATGGATAGATGGTTGGATGATGG - Intergenic
1050225194 9:3446125-3446147 TTGACTGAATGGATAGATGATGG + Intronic
1051173029 9:14338794-14338816 ATAGATAGATGGATGGATGAAGG - Intronic
1051769783 9:20564853-20564875 ATGGCTCAAGGGATTAGTGATGG - Intronic
1052886862 9:33657753-33657775 TTGGGTAAATGGTTTGATTAAGG - Intergenic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1053560508 9:39188977-39188999 ATTGCTATATTGATTGATGGCGG - Intronic
1053824608 9:42009218-42009240 ATTGCTATATTGATTGATGGCGG - Intronic
1054136611 9:61429978-61430000 ATTGCTATATTGATTGATGGCGG + Intergenic
1054458884 9:65451342-65451364 ATGGATGGATGGATGGATGATGG + Intergenic
1054605963 9:67178145-67178167 ATTGCTATATTGATTGATGGCGG + Intergenic
1055182964 9:73412066-73412088 AAGGCTAAATGCATTTATAAGGG + Intergenic
1055328364 9:75155966-75155988 ATGGATTAATGTATTCATGAGGG - Intergenic
1056468590 9:86883421-86883443 TGGGTTAACTGGATTGATGATGG + Intergenic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057828825 9:98391892-98391914 AGGGCAGAATGGATTGAGGAGGG + Intronic
1058774067 9:108266813-108266835 ATGGCCAAATGGATAGGTGGAGG - Intergenic
1059252158 9:112895531-112895553 GTGGGTAGATGGATGGATGATGG - Intergenic
1059252230 9:112895801-112895823 ATGGGTAGATGGATGGATGATGG - Intergenic
1059409075 9:114120756-114120778 ATGGATAGATGAATGGATGATGG + Intergenic
1059416404 9:114165340-114165362 ATGGATGGATGGATGGATGATGG - Intronic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059594070 9:115697191-115697213 ATGACCAAATGGATAAATGAAGG + Intergenic
1059999512 9:119945443-119945465 ATGGCTGAATGAATGAATGATGG + Intergenic
1060880678 9:127116076-127116098 AAGGCTAAATGGGTGGGTGATGG - Intronic
1061256510 9:129456707-129456729 TTGGCTGGATGGATGGATGATGG + Intergenic
1061256561 9:129456945-129456967 ATGGTTGAATGGATGGATGGTGG + Intergenic
1061256674 9:129457476-129457498 ATGGATGGATGGATGGATGATGG + Intergenic
1061417446 9:130454783-130454805 ATGGATGGATGGATGGATGATGG - Intronic
1061417458 9:130454829-130454851 ATGGATGGATGGATGGATGATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417502 9:130455048-130455070 ATGGATGGATGGATGGATGATGG - Intronic
1061417508 9:130455075-130455097 ATGGCTGGATGAATGGATGATGG - Intronic
1061417516 9:130455132-130455154 ATGGATGGATGGATGGATGATGG - Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1061950657 9:133934090-133934112 ATGGCTGGATGGATGGATGATGG + Intronic
1062092309 9:134684894-134684916 ATGGGTGAATGGATAGATGGTGG - Intronic
1062092355 9:134685099-134685121 ATGGATGAATGGATGGATGGTGG - Intronic
1062092388 9:134685251-134685273 ATGACTTAATGGATGGATGGTGG - Intronic
1062092400 9:134685305-134685327 ATGGATGAATGGATGGATGGTGG - Intronic
1062092430 9:134685445-134685467 ATGGATGGATGGATGGATGATGG - Intronic
1062172226 9:135141240-135141262 ATGGATGGATGGATGGATGATGG + Intergenic
1062172281 9:135141647-135141669 ATGGATGGATGGATAGATGATGG + Intergenic
1062172295 9:135141732-135141754 ATGGATGGATGGATAGATGATGG + Intergenic
1062172305 9:135141795-135141817 ATGGATGGATGGATAGATGATGG + Intergenic
1062205450 9:135334269-135334291 TTGGATAAATGGGTGGATGATGG + Intergenic
1062205470 9:135334385-135334407 TTGGATAAATGGATGGATGATGG + Intergenic
1062205489 9:135334505-135334527 TTGGATAAATGGATGGATGATGG + Intergenic
1062247737 9:135578117-135578139 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247806 9:135578463-135578485 ATGGATGAATGGATGGATGCAGG - Intergenic
1062247875 9:135578809-135578831 ATGGATGAATGGATGGATGCAGG - Intergenic
1062520696 9:136956669-136956691 ATGGATGGATGGATGGATGATGG + Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1062520776 9:136957032-136957054 ATGGATAGATGGTTGGATGATGG + Intronic
1185497296 X:565277-565299 GTGGACAAATGGATGGATGATGG + Intergenic
1185497379 X:565747-565769 ATGGGTAGATGGATGCATGATGG + Intergenic
1185497397 X:565874-565896 ATGGATAGATGGATGCATGATGG + Intergenic
1185497422 X:566017-566039 ATGGGTAGATGGATGTATGATGG + Intergenic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185543694 X:924446-924468 ATAGATAGATGGATGGATGATGG + Intergenic
1185547110 X:954450-954472 CTGGATGAATGGATGGATGAGGG - Intergenic
1185583201 X:1226649-1226671 ATGGATAAATGGATGGATTGAGG + Intergenic
1185611416 X:1395598-1395620 ATGGATGGATGGATGGATGATGG + Intergenic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1185629963 X:1508678-1508700 ATGGATGGATGGATGGATGATGG - Intronic
1185629975 X:1508838-1508860 ATGGATGAATGGATGGATGGAGG - Intronic
1185630011 X:1509340-1509362 ATGGATGGATGGATGGATGATGG - Intronic
1185630024 X:1509500-1509522 ATGGATGAATGGATGGATGGAGG - Intronic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185639257 X:1577641-1577663 ATGGATGGATGGATGGATGATGG + Intergenic
1185780599 X:2841432-2841454 ATGGATGGATGGATGGATGATGG + Intronic
1185867852 X:3639265-3639287 ATGGATGGATGGATGGATGAAGG + Intronic
1185867944 X:3639492-3639514 GTGGGTACATGGATGGATGAAGG + Intronic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186002469 X:5028264-5028286 ATGAATAAATGGATAGGTGATGG + Intergenic
1186055577 X:5646182-5646204 ATGGATGGATGGATGGATGATGG - Intergenic
1186178642 X:6951213-6951235 ATGGATGGATGGATGGATGATGG - Intergenic
1187611510 X:20948639-20948661 ATGTGTATATGGATTGATGATGG - Intergenic
1187844744 X:23523851-23523873 AGGGCTAAATGGATTAAGGGTGG + Intergenic
1190143679 X:47870972-47870994 ATGGGCAAATGGATTAAGGAAGG - Intronic
1190973057 X:55371454-55371476 AGGGTTAAATGGATTAAGGAGGG - Intergenic
1191607627 X:63079590-63079612 ATGGCAAACTGGAGTGATCAGGG - Intergenic
1194552633 X:95320340-95320362 ATGGCTAAGTGGAATGCTGAGGG - Intergenic
1196251130 X:113461059-113461081 ATGGCTAAATGGAGTTGTTAGGG + Intergenic
1197270172 X:124416844-124416866 ATTGCTAATTGCATTCATGAAGG - Intronic
1197639402 X:128951427-128951449 ATGGCTATATGCATAGATCACGG - Intergenic
1197658743 X:129146903-129146925 AGGGCTAAATGGGCAGATGATGG - Intergenic
1198434652 X:136604761-136604783 ATGACTAAATGCATAAATGAAGG - Intergenic
1198686431 X:139232646-139232668 ATGGTTGGATGGATGGATGATGG - Intergenic
1199046497 X:143180789-143180811 CTGAGTAAATGGATAGATGATGG + Intergenic
1199457907 X:148050107-148050129 TTTGTTAAATGGATTGATGTAGG + Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1201286823 Y:12386365-12386387 ATAGATGAATGGATGGATGATGG + Intergenic
1201289470 Y:12408675-12408697 ATGGGTGGATGGATGGATGATGG - Intergenic
1201505081 Y:14689609-14689631 ATGGGTAAATGGGTTGGTGGTGG + Intronic
1201523909 Y:14909522-14909544 ATGGATAAATGAATAGATAATGG + Intergenic
1201917383 Y:19196693-19196715 ATGGATTAATGGATGGATGATGG + Intergenic