ID: 975253381

View in Genome Browser
Species Human (GRCh38)
Location 4:72206010-72206032
Sequence GCCATGAAATTCCACATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975253381_975253384 9 Left 975253381 4:72206010-72206032 CCAGGAATGTGGAATTTCATGGC No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data
975253381_975253383 -6 Left 975253381 4:72206010-72206032 CCAGGAATGTGGAATTTCATGGC No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253381_975253386 30 Left 975253381 4:72206010-72206032 CCAGGAATGTGGAATTTCATGGC No data
Right 975253386 4:72206063-72206085 GGTAAGAGTTTAAATAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975253381 Original CRISPR GCCATGAAATTCCACATTCC TGG (reversed) Intergenic