ID: 975253383

View in Genome Browser
Species Human (GRCh38)
Location 4:72206027-72206049
Sequence CATGGCACAGACTTGGACGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975253376_975253383 9 Left 975253376 4:72205995-72206017 CCCATTCGATCACCTCCAGGAAT No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253373_975253383 15 Left 975253373 4:72205989-72206011 CCCTGGCCCATTCGATCACCTCC No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253381_975253383 -6 Left 975253381 4:72206010-72206032 CCAGGAATGTGGAATTTCATGGC No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253372_975253383 19 Left 975253372 4:72205985-72206007 CCAGCCCTGGCCCATTCGATCAC No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253377_975253383 8 Left 975253377 4:72205996-72206018 CCATTCGATCACCTCCAGGAATG No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253371_975253383 20 Left 975253371 4:72205984-72206006 CCCAGCCCTGGCCCATTCGATCA No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253374_975253383 14 Left 975253374 4:72205990-72206012 CCTGGCCCATTCGATCACCTCCA No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data
975253379_975253383 -3 Left 975253379 4:72206007-72206029 CCTCCAGGAATGTGGAATTTCAT No data
Right 975253383 4:72206027-72206049 CATGGCACAGACTTGGACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975253383 Original CRISPR CATGGCACAGACTTGGACGT TGG Intergenic