ID: 975253384

View in Genome Browser
Species Human (GRCh38)
Location 4:72206042-72206064
Sequence GACGTTGGTGAGTATGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975253377_975253384 23 Left 975253377 4:72205996-72206018 CCATTCGATCACCTCCAGGAATG No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data
975253381_975253384 9 Left 975253381 4:72206010-72206032 CCAGGAATGTGGAATTTCATGGC No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data
975253374_975253384 29 Left 975253374 4:72205990-72206012 CCTGGCCCATTCGATCACCTCCA No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data
975253376_975253384 24 Left 975253376 4:72205995-72206017 CCCATTCGATCACCTCCAGGAAT No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data
975253379_975253384 12 Left 975253379 4:72206007-72206029 CCTCCAGGAATGTGGAATTTCAT No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data
975253373_975253384 30 Left 975253373 4:72205989-72206011 CCCTGGCCCATTCGATCACCTCC No data
Right 975253384 4:72206042-72206064 GACGTTGGTGAGTATGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975253384 Original CRISPR GACGTTGGTGAGTATGCCTG CGG Intergenic